Why God is so l33t

A place to discuss the implementation and style of computer programs.

Moderators: phlip, Moderators General, Prelates

ZeroSkulleton
Posts: 26
Joined: Sun Dec 20, 2009 1:19 am UTC

Why God is so l33t

Postby ZeroSkulleton » Mon May 10, 2010 3:57 am UTC

He created a programming language using only the characters A, C, G and T.

User avatar
scarecrovv
It's pronounced 'double u'
Posts: 674
Joined: Wed Jul 30, 2008 4:09 pm UTC
Location: California

Re: Why God is so l33t

Postby scarecrovv » Mon May 10, 2010 4:01 am UTC

He's not as 1337 as people. We created programming languages using only 1 and 0.

edit: but of course, nobody who gets any work done actually uses said languages directly.

ZeroSkulleton
Posts: 26
Joined: Sun Dec 20, 2009 1:19 am UTC

Re: Why God is so l33t

Postby ZeroSkulleton » Mon May 10, 2010 4:18 am UTC

Well, yes and no. 1 and 0 represent "on" and "off". Sounds like the epigenome to me, but I don't want to get into that.

Besides, we use commands and whatnot to write our 1s and 0s.

God just punches out code. TACTTCTCCAGGTCAACTTAGCCTCGAAGTAGGTCTAAGTCGGGCTATTTATCCTA

Its like going from Notepad to Dreamweaver.

User avatar
Steax
SecondTalon's Goon Squad
Posts: 3038
Joined: Sat Jan 12, 2008 12:18 pm UTC

Re: Why God is so l33t

Postby Steax » Mon May 10, 2010 5:44 am UTC

ZeroSkulleton wrote:Its like going from Notepad to Dreamweaver.

You might want to find a better metaphor for this, because I don't really see why dreamweaver is much better than notepad. And many others would probably agree.

The only reason I'd use dreamweaver would be for preserving the indenting when hitting return... And maybe syntax highlighting.
In Minecraft, I use the username Rirez.

User avatar
phlip
Restorer of Worlds
Posts: 7572
Joined: Sat Sep 23, 2006 3:56 am UTC
Location: Australia
Contact:

Re: Why God is so l33t

Postby phlip » Mon May 10, 2010 5:51 am UTC

ZeroSkulleton wrote:God just punches out code. TACTTCTCCAGGTCAACTTAGCCTCGAAGTAGGTCTAAGTCGGGCTATTTATCCTA

How do you know? Maybe the DNA bases are just the object code, and he uses some kind of IDE and compiler to build it.

Code: Select all

enum ಠ_ಠ {°□°╰=1, °Д°╰, ಠ益ಠ╰};
void ┻━┻︵​╰(ಠ_ಠ ⚠) {exit((int)⚠);}
[he/him/his]

User avatar
Xeio
Friends, Faidites, Countrymen
Posts: 5101
Joined: Wed Jul 25, 2007 11:12 am UTC
Location: C:\Users\Xeio\
Contact:

Re: Why God is so l33t

Postby Xeio » Mon May 10, 2010 6:15 am UTC

phlip wrote:
ZeroSkulleton wrote:God just punches out code. TACTTCTCCAGGTCAACTTAGCCTCGAAGTAGGTCTAAGTCGGGCTATTTATCCTA
How do you know? Maybe the DNA bases are just the object code, and he uses some kind of IDE and compiler to build it.
Probabaly, I mean who would want to write the code for legs a few billion times? Unless... god is a bad programmer who copy-pastes... that would explain a lot...

Axidos
Posts: 167
Joined: Tue Jan 20, 2009 12:02 pm UTC
Location: trapped in a profile factory please send help

Re: Why God is so l33t

Postby Axidos » Mon May 10, 2010 11:10 am UTC

He didn't create our genes, they created themselves by accident. What he did create was matter and energy, so God just programmed the universe using quarks and gluons and energy. From the quantum-physics scale discrepancies he must have used some pretty ugly hacks to get it working, and keeping photons in mind he probably had some multiple class inheritance going on.

The code maintenance must be a nightmare.

User avatar
Josephine
Posts: 2142
Joined: Wed Apr 08, 2009 5:53 am UTC

Re: Why God is so l33t

Postby Josephine » Mon May 10, 2010 11:25 am UTC

Axidos wrote:
The code maintenance must be a nightmare.

Nah. The Anthropic principle applies. This is just one of the universes that worked right.
Belial wrote:Listen, what I'm saying is that he committed a felony with a zoo animal.

User avatar
MHD
Posts: 630
Joined: Fri Mar 20, 2009 8:21 pm UTC
Location: Denmark

Re: Why God is so l33t

Postby MHD » Mon May 10, 2010 1:32 pm UTC

God had a compiler that compiled into Qbit object code.

Also, the language was Lisp and Haskell hacked together with Perl.
EvanED wrote:be aware that when most people say "regular expression" they really mean "something that is almost, but not quite, entirely unlike a regular expression"

User avatar
Jplus
Posts: 1721
Joined: Wed Apr 21, 2010 12:29 pm UTC
Location: Netherlands

Re: Why God is so l33t

Postby Jplus » Mon May 10, 2010 2:03 pm UTC

I think God had the second law of thermodynamics as his programming paradigm, not OOP or functional programming. :P

As for DNA, I think it's more like a database than like a program. The ribosomes and the enzymes, as well as the general structure of the cell, are the real programs.
"There are only two hard problems in computer science: cache coherence, naming things, and off-by-one errors." (Phil Karlton and Leon Bambrick)

coding and xkcd combined

(Julian/Julian's)

ZeroSkulleton
Posts: 26
Joined: Sun Dec 20, 2009 1:19 am UTC

Re: Why God is so l33t

Postby ZeroSkulleton » Mon May 10, 2010 7:01 pm UTC

If God didn't use ACGT straight-up, he wouldn't need to use ugly hax like Uracil.

User avatar
TheChewanater
Posts: 1279
Joined: Sat Aug 08, 2009 5:24 am UTC
Location: lol why am I still wearing a Santa suit?

Re: Why God is so l33t

Postby TheChewanater » Mon May 10, 2010 7:44 pm UTC

Xeio wrote:Probabaly, I mean who would want to write the code for legs a few billion times?

No, He just wrote two sets of DNA and they took care of the rest. Most of the code was reused from other primates anyways.
ImageImage
http://internetometer.com/give/4279
No one can agree how to count how many types of people there are. You could ask two people and get 10 different answers.

ZeroSkulleton
Posts: 26
Joined: Sun Dec 20, 2009 1:19 am UTC

Re: Why God is so l33t

Postby ZeroSkulleton » Tue May 11, 2010 12:05 am UTC

Wanna get technical? Eve was created from Adam's rib. They shared Genetic Material. Except the X Chromosome was duplicated. So Eve likely had Klinefelter's.

Themaister
Posts: 8
Joined: Sat Jan 09, 2010 3:19 pm UTC

Re: Why God is so l33t

Postby Themaister » Tue May 18, 2010 4:54 pm UTC

God obviously implemented fork(), so he must have been a Unix fan. It's probably the most used call in the universe after all :)

User avatar
evilbeanfiend
Posts: 2650
Joined: Tue Mar 13, 2007 7:05 am UTC
Location: the old world

Re: Why God is so l33t

Postby evilbeanfiend » Tue May 18, 2010 8:48 pm UTC

god does not exist, the universe bootstrapped itself.
in ur beanz makin u eveel

squareroot
Posts: 548
Joined: Tue Jan 12, 2010 1:04 am UTC
Contact:

Re: Why God is so l33t

Postby squareroot » Wed May 19, 2010 5:56 am UTC

I'm surprised no one's done this yet:

God used a genetic algorithm, people. The other planets are just failed genomes, but his garbage collection was really poor.

And I'm afraid the quantized universe/rounding error joke is OLD.

And I think he DID type it all out himself. Except he just did it in rocks, in a big 'ol desert-o'-creation! Once God made the computer, God was happy, so he gave God rain. It buried the rocks, and turned the desert in the Garden of Eden.

Omigod, that actually almost makes sense (or it would, if I had stronger faith) - does Randall Munroe know the secret of creation!??!
<signature content="" style="tag:html;" overused meta />
Good fucking job Will Yu, you found me - __ -

User avatar
maushu
Posts: 8
Joined: Fri Apr 09, 2010 9:26 am UTC
Location: Portugal
Contact:

Re: Why God is so l33t

Postby maushu » Wed May 19, 2010 4:22 pm UTC

Everyone here is wrong.
The universe was perfect, everything fit and worked perfectly, until a particle was in the wrong position and BANG, everything went nuts.

...

Yes, we are currently in the universe's version of BSOD.
You just wasted some seconds trying to see what this phrase said. You probably have too much free time on your hands.

User avatar
PM 2Ring
Posts: 3713
Joined: Mon Jan 26, 2009 3:19 pm UTC
Location: Sydney, Australia

Re: Why God is so l33t

Postby PM 2Ring » Wed May 19, 2010 6:18 pm UTC

If it was working perfectly, how did a particle get into the wrong position?

And it's not a BSOD, it's a core dump.

:D

Axidos
Posts: 167
Joined: Tue Jan 20, 2009 12:02 pm UTC
Location: trapped in a profile factory please send help

Re: Why God is so l33t

Postby Axidos » Wed May 19, 2010 11:18 pm UTC

PM 2Ring wrote:If it was working perfectly, how did a particle get into the wrong position?

Gamma rays flipped a bit? Hamming codes weren't invented til 13 billion years later.

I like to imagine the big bang was caused by a time machine suddenly appearing because someone tried to reach the year NULL.

squareroot
Posts: 548
Joined: Tue Jan 12, 2010 1:04 am UTC
Contact:

Re: Why God is so l33t

Postby squareroot » Wed May 19, 2010 11:22 pm UTC

PM 2Ring wrote:If it was working perfectly, how did a particle get into the wrong position?

And it's not a BSOD, it's a core dump.

:D


Hacked by the archangel computer nerds?
<signature content="" style="tag:html;" overused meta />
Good fucking job Will Yu, you found me - __ -

User avatar
maushu
Posts: 8
Joined: Fri Apr 09, 2010 9:26 am UTC
Location: Portugal
Contact:

Re: Why God is so l33t

Postby maushu » Thu May 20, 2010 1:03 pm UTC

Axidos wrote:
PM 2Ring wrote:If it was working perfectly, how did a particle get into the wrong position?

I like to imagine the big bang was caused by a time machine suddenly appearing because someone tried to reach the year NULL.

Very, very close. If I find the time later on I will tell you the story of the universe the multiverse! the dimension EVERYTHING.

:lol:
You just wasted some seconds trying to see what this phrase said. You probably have too much free time on your hands.

Agent_Irons
Posts: 213
Joined: Wed Sep 10, 2008 3:54 am UTC

Re: Why God is so l33t

Postby Agent_Irons » Tue May 25, 2010 6:49 am UTC

At the highest level there's methylated DNA and ATCG At least 5 bits(less with compression(still >4) because methylation is predictable, etc). Go a level down and technically speaking God could have used all the different atoms, because the epigenome is regulated with methyl(CH3) groups. And there's the ribose backbone which requires C,H,and O, and the phosphates which require P as well, and so on. That's at least 4. So if he's using atoms, there's more than two. If he's using protons, there are also neutrons and electrons. If he's using quarks he needs up, down and he still needs electrons. Whoops.

Moral: People > God at designing things.

User avatar
Argency
Posts: 203
Joined: Wed May 19, 2010 12:43 am UTC
Location: Brisbane, Australia

Re: Why God is so l33t

Postby Argency » Tue May 25, 2010 10:23 am UTC

maushu wrote:Everyone here is wrong.
The universe was perfect, everything fit and worked perfectly, until a particle was in the wrong position and BANG, everything went nuts.

...

Yes, we are currently in the universe's version of BSOD.


David Eddings much?
Gonna be a blank slate, gonna wear a white cape.

YoungStudent
Posts: 127
Joined: Wed Sep 10, 2008 10:14 am UTC

Re: Why God is so l33t

Postby YoungStudent » Wed May 26, 2010 7:23 pm UTC

God's code is bulls*it, every error in the code is represented in black hole, instead of complete system crash. And since there are many black hole's in our universe, means that God is very, very, lasy coder.
Okay, quote me - We try to explain magic, presence of spirits and supernatural with science, which only explains 'the physical world' that we observe. It's like blind earthworm declaring that there is no light.

User avatar
TheChewanater
Posts: 1279
Joined: Sat Aug 08, 2009 5:24 am UTC
Location: lol why am I still wearing a Santa suit?

Re: Why God is so l33t

Postby TheChewanater » Wed May 26, 2010 11:24 pm UTC

Black holes are symlinks to /dev/null. There's made to keep us fearful of traveling too far since He never bothered to implement a true multi-user system, so /usr is writable to everyone.
ImageImage
http://internetometer.com/give/4279
No one can agree how to count how many types of people there are. You could ask two people and get 10 different answers.

YoungStudent
Posts: 127
Joined: Wed Sep 10, 2008 10:14 am UTC

Re: Why God is so l33t

Postby YoungStudent » Thu May 27, 2010 10:09 am UTC

Let's decrypt the universe and play the god.
Okay, quote me - We try to explain magic, presence of spirits and supernatural with science, which only explains 'the physical world' that we observe. It's like blind earthworm declaring that there is no light.

User avatar
TheChewanater
Posts: 1279
Joined: Sat Aug 08, 2009 5:24 am UTC
Location: lol why am I still wearing a Santa suit?

Re: Why God is so l33t

Postby TheChewanater » Thu May 27, 2010 6:08 pm UTC

Assuming we can get root access, we can corrupt His apt and run rm -r /heaven/* if He tries to stop us.
Last edited by TheChewanater on Thu May 27, 2010 6:24 pm UTC, edited 1 time in total.
ImageImage
http://internetometer.com/give/4279
No one can agree how to count how many types of people there are. You could ask two people and get 10 different answers.

User avatar
Dason
Posts: 1311
Joined: Wed Dec 02, 2009 7:06 am UTC
Location: ~/

Re: Why God is so l33t

Postby Dason » Thu May 27, 2010 6:19 pm UTC

TheChewanater wrote:Assuming we can get root access, we can corrupt His apt and run rm -r /heavan/* if He tries to stop us.

I don't think he'll mind too much
double epsilon = -.0000001;

User avatar
TheChewanater
Posts: 1279
Joined: Sat Aug 08, 2009 5:24 am UTC
Location: lol why am I still wearing a Santa suit?

Re: Why God is so l33t

Postby TheChewanater » Thu May 27, 2010 6:24 pm UTC

Fix'd. (My phone's spell check sucks.)

Also, cat /dev/hell > /dev/heaven.
ImageImage
http://internetometer.com/give/4279
No one can agree how to count how many types of people there are. You could ask two people and get 10 different answers.

YoungStudent
Posts: 127
Joined: Wed Sep 10, 2008 10:14 am UTC

Re: Why God is so l33t

Postby YoungStudent » Sun May 30, 2010 5:51 pm UTC

Now all we gotta do is find an glitch in quantum physics and hacking can begin.

This thread can't die, or i as your future god will be very sad.
Okay, quote me - We try to explain magic, presence of spirits and supernatural with science, which only explains 'the physical world' that we observe. It's like blind earthworm declaring that there is no light.

User avatar
styrofoam
Posts: 256
Joined: Sat May 08, 2010 3:28 am UTC

Re: Why God is so l33t

Postby styrofoam » Sun May 30, 2010 9:04 pm UTC

YoungStudent wrote:Now all we gotta do is find an glitch in quantum physics and hacking can begin.

Unfortunately, we don't really know how it's SUPPOSED to act, so it's hard to tell a bug from a feature.
aadams wrote:I am a very nice whatever it is I am.

User avatar
Jplus
Posts: 1721
Joined: Wed Apr 21, 2010 12:29 pm UTC
Location: Netherlands

Re: Why God is so l33t

Postby Jplus » Sun May 30, 2010 9:06 pm UTC

Maybe we can better try to exploit a buffer overflow in gravitation?
"There are only two hard problems in computer science: cache coherence, naming things, and off-by-one errors." (Phil Karlton and Leon Bambrick)

coding and xkcd combined

(Julian/Julian's)

YoungStudent
Posts: 127
Joined: Wed Sep 10, 2008 10:14 am UTC

Re: Why God is so l33t

Postby YoungStudent » Thu Jun 03, 2010 7:48 am UTC

I wonder what god's code look like.

Code: Select all

include(universe.api);
include(death.api);
begin
 if(get(human.death)){
  get(params.evil_rate.good_rate);
  if (evil_rate > good_rate) {
   send(human.hell);
  }
  else
  {
  send(human.heaven);
  }
}
end


Things must be simple, eh?
Okay, quote me - We try to explain magic, presence of spirits and supernatural with science, which only explains 'the physical world' that we observe. It's like blind earthworm declaring that there is no light.

Axidos
Posts: 167
Joined: Tue Jan 20, 2009 12:02 pm UTC
Location: trapped in a profile factory please send help

Re: Why God is so l33t

Postby Axidos » Thu Jun 03, 2010 9:01 am UTC

More like:

Code: Select all

from * import *

class human:
    MAX_GOODNESS = 100;
    REQUIRED_HEAVEN_GOODNESS = 103;
   
    def die(self):
        if (self.getGoodness >= REQUIRED_HEAVEN_GOODNESS):
            send(place.hell)
        else:
            raise NotImplementedError, "To do"

YoungStudent
Posts: 127
Joined: Wed Sep 10, 2008 10:14 am UTC

Re: Why God is so l33t

Postby YoungStudent » Thu Jun 03, 2010 10:48 am UTC

If so, it's epic.

/me liek this topic.
Okay, quote me - We try to explain magic, presence of spirits and supernatural with science, which only explains 'the physical world' that we observe. It's like blind earthworm declaring that there is no light.

User avatar
TheChewanater
Posts: 1279
Joined: Sat Aug 08, 2009 5:24 am UTC
Location: lol why am I still wearing a Santa suit?

Re: Why God is so l33t

Postby TheChewanater » Thu Jun 03, 2010 6:37 pm UTC

There's no way we were written in an interpreted language. Those are blasphemy.

Code: Select all

class human : public ape
{
public:
  human (char genes[50000]); 
  ~human (int cause);
private:
  double goodness;
};
Last edited by TheChewanater on Fri Jun 04, 2010 2:55 am UTC, edited 1 time in total.
ImageImage
http://internetometer.com/give/4279
No one can agree how to count how many types of people there are. You could ask two people and get 10 different answers.

squareroot
Posts: 548
Joined: Tue Jan 12, 2010 1:04 am UTC
Contact:

Re: Why God is so l33t

Postby squareroot » Fri Jun 04, 2010 1:09 am UTC

I'm placing my bets now that God wrote the universe in LOLCODE. It's only the deep-seated holiness of the language that let it ever survive.
<signature content="" style="tag:html;" overused meta />
Good fucking job Will Yu, you found me - __ -

Axidos
Posts: 167
Joined: Tue Jan 20, 2009 12:02 pm UTC
Location: trapped in a profile factory please send help

Re: Why God is so l33t

Postby Axidos » Fri Jun 04, 2010 12:26 pm UTC

TheChewanater wrote:There's no way we were written in an interpreted language. Those are blasphemy.

Code: Select all

class human : public ape
{
public:
  human (char genes[50000]); 
  ~human (int cause);
private:
  double goodness;
};


TheChewanater wrote:

Code: Select all

private:
  double goodness;

What do you want to bet a massive percentage get denied access to heaven due to rounding errors?

User avatar
styrofoam
Posts: 256
Joined: Sat May 08, 2010 3:28 am UTC

Re: Why God is so l33t

Postby styrofoam » Fri Jun 04, 2010 2:26 pm UTC

Axidos wrote:What do you want to bet a massive percentage get denied access to heaven due to rounding errors?


Code: Select all

#include "human.h"
#include "universe.h"
enum {
    MAX_GOODNESS = 9999,
    MIN_GOODNESS = 0,
    HEAVENLY_GOODNESS = 99999
}
human::human(char genes[50000]) : ape(genes) {
    brain()->set_soul(new soul(this));
    if (MAX_GOODNESS < goodness) {
        goodness = MAX_GOODNESS;
    } else if (MIN_GOODNESS >= goodness && this != universe::self()->get_human_by_name('Adolf Hitler')) {
        goodness = MIN_GOODNESS;
    }
}
human::~human(int cause) {
    // parser error here (destructor cannot have arguments). I always thought there was something fundementally wrong with the universe...
    // try a private destructor and a die() method.
    if (goodness < HEAVENLY_GOODNESS) {
        universe::self()->hell()->insert(brain()->soul());
    } else {
        true; // not implemented
    }
}
aadams wrote:I am a very nice whatever it is I am.

User avatar
'; DROP DATABASE;--
Posts: 3284
Joined: Thu Nov 22, 2007 9:38 am UTC
Location: Midwest Alberta, where it's STILL snowy
Contact:

Re: Why God is so l33t

Postby '; DROP DATABASE;-- » Fri Jun 11, 2010 4:00 am UTC

Guys guys guys, obviously the universe was written in Lua. *ducks*
Axidos wrote:
PM 2Ring wrote:If it was working perfectly, how did a particle get into the wrong position?

Gamma rays flipped a bit? Hamming codes weren't invented til 13 billion years later.

I like to imagine the big bang was caused by a time machine suddenly appearing because someone tried to reach the year NULL.
And after all the mess that caused, time travel was banned forever, the machines and plans destroyed, which is why we never see any time travellers.
poxic wrote:You suck. And simultaneously rock. I think you've invented a new state of being.


Return to “Coding”

Who is online

Users browsing this forum: No registered users and 10 guests