Research

For the discussion of the sciences. Physics problems, chemistry equations, biology weirdness, it all goes here.

Moderators: gmalivuk, Moderators General, Prelates

User avatar
telcontar42
Posts: 430
Joined: Sat Jun 28, 2008 10:33 pm UTC
Location: Davis, CA
Contact:

Research

Postby telcontar42 » Sun Aug 17, 2008 7:50 am UTC

So, I'm sitting here in a lab at 3:35 AM waiting for a finish taking a measurement so I can go to sleep, and I was wondering what kind of research other people in xkcdland are involved in. It's a pretty science oriented community so I'm sure there are plenty of people doing some pretty interesting work.

As for myself, I'm an undergraduate in physics. I've been working in a polymer physics lab for a couple of years now. I am mainly looking at the crystal structure of a few polymers, such as PVDF (a piezoelectric material) and PET (used in many soda bottles). I mostly use dielectric spetroscopy (applying an alternating electric field to the material and looking at how the movement of electric dipoles in the material effect the field) and x-ray diffractometry (hitting the material with a beam of x-rays and watching how they scatter to determine the periodicity of the molecules, which tells you about the crystal structure). Right now I'm at Brookhaven National Labratory using the synchotron light source here (that's why I'm working at 4 in the morning, we only have limited time to use this equipment, I don't usually work through the night). It's pretty cool to be working with an accelerator, even if I'm just using one of the many beam lines off of it.

So what kind of research are you doing or have you done in the past? I was particulary thinking about science, but if people are doing research in other fields that would certainly be cool to hear about too.

hitokiriilh
Posts: 244
Joined: Fri Aug 10, 2007 9:15 pm UTC
Location: UVa
Contact:

Re: Research

Postby hitokiriilh » Sun Aug 17, 2008 8:27 am UTC

A week ago I would have been running some macros to calculate measurement resolution of [imath]Q^2[/imath] and X-Bjorken for various detector geometries for upcoming 12 GeV parity violating electron-nucleon deep inelastic scattering experiments aimed at assessing electroweak asymmetries to high precision...it might sound fancy, but I pretty much amounted to a glorified code monkey who gets to use the word 'asymmetry'. The experiments probe physics beyond the standard model; the simulations pretty much said "yep, this is a good design for a detector." I just finished giving a presentation of the results to the 12 GeV group at JLab (TJNAF). It's amazing how some people shit themselves over the most boring things. (Incidentally, I could never be an experimentalist - I'm good at it, but it's boring as sin to have to worry about so many non-physics related things.)

Before that I co-developed a novel acoustic modality of the atomic force microscope and used it to take pretty pictures of subsurface nanostructures embedded in polymer matrix materials. The apparatus was infuriating, but the research experience was worthwhile.

Most of the stuff I do now is actually on side-projects. Lately I've been toying around with eliminating the use of particles (classically) and formulating the theories in terms of just the fields the particles generate. It might seem trivial at first, but this is actually not the case. 1) Fields frequently carry internal angular momentum as a Noether charge and if particles are viewed as, say, a local divergence of a field, there is a natural way in which classical spin is introduce to the particles. 2) Particles generate multiple fields and removing particles from the theories of E&M, gravitational, strong, and weak interactions consistently and simultaneously demands a form of unification of the fields and, hopefully, will suggest a method of doing so. 3) Apparently quantum mechanics and special relativity haven't been proven to be mathematically consistent in 4+ dimensions (A. Jaffe managed to show they are in 2 and 3 dimensions, but particle physicists have just been making the assumption for 4+ for the last 60 years). I think this is a trivial problem that only mathematical physicists get off on, but nonetheless if the particle terms from a Langrangian are eliminated, so are the interaction terms and if the theory is quantized it then circumvents the issue of interactions (although the theory would involve self-interactions, but I don't actually know if this would be a problem or not...>.< I should probably find out before presenting 3) in an official presentation or something).

And your research sounds pretty exciting! In particular I think the dielectric spectroscopy sounds interesting. Think you could provide a bit more information about it? What kind of effects are you looking for? Elementary treatments of ideal dielectrics are pretty straightforward and linear. Are you looking for effects that are non-linear in the field or something? Anywho, again, spiffy stuff. Never been to Brookehaven but I'd like to see the place.

User avatar
MillerTime
Posts: 12
Joined: Sun Aug 03, 2008 2:46 pm UTC
Location: Nebraska

Re: Research

Postby MillerTime » Sun Aug 17, 2008 3:41 pm UTC

I'm currently an undergrad doing some research on the plasticity of the gustatory system of rats, specifically looking at the differences of creating lesions on neonatal rat pups versus older rats. Basically we take several rats that are <10 days old and create a lesion on their chorda tympani nerves and follow up with cell body counts on the chorda tympani with groups of 2-3 at different ages (group 1 will age to 15 days, 2 will age to 30, 3 to 45... ect.) and we also count taste buds on the tongue surface and note the unusual taste bud structures that arise from a tongue with lesions. We do most of the counting with either a confocal microscope or the TEM. For the most part I get to profuse the rats and count the cell bodies, the grad student is more of the brains and I get to hang along and learn all sorts of fun things. Also confocal and electron microscopy are amazing.
"I'm sciencing as fast as I can!" -Hubert J. Farnsworth-
"The world is a mess... and I just need to rule it." -Dr. Horrible-

Spudgun
Posts: 46
Joined: Fri Aug 24, 2007 4:33 pm UTC
Location: Wales, UK
Contact:

Re: Research

Postby Spudgun » Sun Aug 17, 2008 4:00 pm UTC

MillerTime wrote:I'm currently an undergrad doing some research on the plasticity of the gustatory system of rats, specifically looking at the differences of creating lesions on neonatal rat pups versus older rats. Basically we take several rats that are <10 days old and create a lesion on their chorda tympani nerves and follow up with cell body counts on the chorda tympani with groups of 2-3 at different ages (group 1 will age to 15 days, 2 will age to 30, 3 to 45... ect.) and we also count taste buds on the tongue surface and note the unusual taste bud structures that arise from a tongue with lesions. We do most of the counting with either a confocal microscope or the TEM. For the most part I get to profuse the rats and count the cell bodies, the grad student is more of the brains and I get to hang along and learn all sorts of fun things. Also confocal and electron microscopy are amazing.


That sounds like some interesting research, do you mind telling me what your major is?

User avatar
telcontar42
Posts: 430
Joined: Sat Jun 28, 2008 10:33 pm UTC
Location: Davis, CA
Contact:

Re: Research

Postby telcontar42 » Sun Aug 17, 2008 4:48 pm UTC

hitokiriilh wrote:And your research sounds pretty exciting! In particular I think the dielectric spectroscopy sounds interesting. Think you could provide a bit more information about it? What kind of effects are you looking for?

We are maninly using the dielectric measurements to learn about the molecular mobility of the material. Looking at how the electric dipoles are able to move in reaction to the alternating electric field tells about how much of the molecules are in a crystal phase, and much have their mobility restricted by the crystals, and how much are able to move more freely in an amorphous phase. This can tell you a lot about what kind of crystal strucutre you have in the material, particularly when you compare it to x-ray diffraction, and a variety of other kinds of studies.

We also do a lot with polymer nanocomposites. A little bit of carbon nanotubes or clay mixed into the polymer can have a surprisingly large effect on crystallization.

User avatar
Sungura
When life gives you banananas, make bananana bread
Posts: 3911
Joined: Sat Jan 12, 2008 2:32 am UTC
Location: AL

Re: Research

Postby Sungura » Mon Aug 18, 2008 1:29 am UTC

I do a lot of assay development, for various things. Just finished a sandwich ELISA for Glutathione S-Transferase Alpha which will be put on the market soon. Other projects include making conjugations (small molecules to BSA, KLH, etc) to make antibodies which involves some organic fun :) I've done a lot of other things too, everything is very biotech orientated. I start grad school in two weeks so I'll be doing more of my own research which will be nice.

On my own, I study chronic pain (just journal searches) most recently OIH (Opioid Induced Hyperalgesia). I also study rabbit coat color genetics.
"Would you rather fight a Sungura-sized spider or 1000 spider-sized Sunguras?" -Zarq
she/<any gender neutral>/snug

qetzal
Posts: 861
Joined: Thu May 01, 2008 12:54 pm UTC

Re: Research

Postby qetzal » Mon Aug 18, 2008 1:59 am UTC

I currently work on aptamers - small pieces of DNA or RNA that fold into specific shapes and bind to specific molecules. Sort of like small oligonucleotide versions of antibodies, except you can select for them in a test tube (rather than in an animal), and you can get them to bind to all kinds of things that don't work so well with antibodies - everything from small molecules (e.g. single amino acids) to proteins to whole cells.

Worked for quite a few years in gene therapy, trying to treat things like cancer & circulatory disease. Very interesting, but ultimately unsuccessful.

Done a few other things, all in biotech. Haven't done any basic research since post-doc & grad school.

User avatar
RockoTDF
Posts: 582
Joined: Thu Oct 18, 2007 6:08 am UTC
Location: Tucson, AZ, US
Contact:

Re: Research

Postby RockoTDF » Mon Aug 18, 2008 2:09 am UTC

Undergrad Psych major currently studying bubble nesting in betta splendens. The focus of my work this summer has been moving the lab I work in down the hall and developing image analysis methodologies. Currently most researchers throw a sheet of plastic with 0.5cm2 gridlines on it and get a sloppy idea of how large the nests are. Unfortunately due to this lab move, a potentially fried motherboard and a slack IT department, I haven't been able to get as much done as I would like. I'm writing macros for a program called SigmaScan in VB5 because it was originally written for Windows 95. (btw, if you need an image analysis program for any sort of bio/chem research, this program can do all sorts of fun things for $1000)

Once I have the methodology done, I'll probably try to get it published and then apply it to study the effects of estrodial and aggression on bubble nesting.
Just because it is not physics doesn't mean it is not science.
http://www.iomalfunction.blogspot.com <---- A collection of humorous one liners and science jokes.

User avatar
grim heart
Posts: 48
Joined: Tue Sep 04, 2007 7:15 am UTC
Location: northern forests

Re: Research

Postby grim heart » Mon Aug 18, 2008 2:11 am UTC

I'm in the planning stages of a possible honour's thesis for my B.Sc. Geology. It's going to involve staking a claim, mapping it (outcrop, overburden), taking samples thin sections (microscope), possible ground-based geophysics survey, and then doing all of the interpretation at a later date. Pretty stoked.

User avatar
RAPTORATTACK!!!
Posts: 72
Joined: Sat Sep 30, 2006 8:48 pm UTC
Location: Aroundabouts boston.

Re: Research

Postby RAPTORATTACK!!! » Mon Aug 18, 2008 2:32 am UTC

Not so much research, but I'm helping with BU's nanosat project. not doing a whole lot, my friend and I were occasionally helping fabrication and wiring. Until, unavoidably, they realized we were doing stuff that (god forbid), mattered, so we had to stop. Now we watch as college students talk about bongs for half an hour then break bits of our mill...

Now it wont home correctly and we don't know how to fix it. (go to the default position, so we cant make anything accurately)
Image
Team 246 OVERCLOCKED!

User avatar
markkat
Posts: 107
Joined: Wed May 02, 2007 4:37 pm UTC
Location: Mitten
Contact:

Re: Research

Postby markkat » Mon Aug 18, 2008 4:11 am UTC

Studying the role of a particular protease in tumorgenesis. My day involves everything from creating DNA plasmids to tumor implantation. Fun, but can be very frustrating at times.
I don't know how 5E D&D will be played, but 6E D&D will be played with paper and pencils.
Wayfarers Role-playing Game. -Ye Olde Gaming Companye.

lastscattering
Posts: 7
Joined: Mon Jun 09, 2008 9:36 pm UTC

Re: Research

Postby lastscattering » Mon Aug 18, 2008 4:25 am UTC

I'm currently an undergrad astro- and physics- major, but all my research is in the realm of theoretical astrophysics; I mostly look at large cosmological simulations. I have written a series of programs to do analysis of galactic structure - for example, a program to create template rotation curves of sets of hundreds of galaxies. It's cool because I can look at each galaxy with all of its components, or I can look solely at dark matter, stars, or dust. Also because such things as rotation curves, which are a primary source of information about the distribution of dark matter within observed galaxies, can be compared to their simulated counterparts to effectively be tracers of the actual amounts and distributions of dark matter. It's some pretty fun stuff :)

sgt york
Posts: 331
Joined: Mon Oct 01, 2007 7:21 pm UTC
Location: Chapel Hill, NC
Contact:

Re: Research

Postby sgt york » Mon Aug 18, 2008 4:27 am UTC

In a nutshell, host-pathogen and mixed pathogen intracommunity interactions in the lung. Got my start in asthma in the mid 1990s. A resurgence of the Dutch hypothesis turned me to COPD ~2002, and I now have found myself in a cystic fibrosis lab, working on complex infections.

Right now, I'm kind of stuck until the next NIH upswing, which I expect to hit ~2009-2010. I hope. After that, I have better hopes of getting back into my real love, wound healing and fibrosis. Unless I get sidetracked by mixed species biofilms. They're pretty damn cool, and I'm starting to believe the people that say they're important in COPD.

Besides, the idea that a person could have obligate anaerobes living in their lungs is too damn cool to simply walk away from.

User avatar
ZZCat13
Posts: 26
Joined: Tue Dec 18, 2007 9:00 am UTC
Contact:

Re: Research

Postby ZZCat13 » Mon Aug 18, 2008 5:37 am UTC

sgt york wrote:Besides, the idea that a person could have obligate anaerobes living in their lungs is too damn cool to simply walk away from.


That IS cool. Now I'm suddenly intensely curious as to what kind of bugs they are.

This thread seems biology-heavy, and I'm no exception. I'm an undergrad at a tiny little no-name state university studying human neural stem cells, particularly their reaction to antioxidants - whether they grow faster, turn into different types of cells, etc. We're hoping to find a treatment for neurodegenerative diseases like Alzheimer's and multiple sclerosis. It's pretty nifty, and it helps that I love the people in my research group.
"To make an apple pie from scratch, you must first create the universe." - Carl Sagan

sgt york
Posts: 331
Joined: Mon Oct 01, 2007 7:21 pm UTC
Location: Chapel Hill, NC
Contact:

Re: Research

Postby sgt york » Mon Aug 18, 2008 1:26 pm UTC

ZZCat13 wrote:
That IS cool. Now I'm suddenly intensely curious as to what kind of bugs they are.



Two studies in cystic fibrosis that lead to the idea & made us start looking more closely. Our newer data suggest these studies underestimate the incidence of these bugs, and I think we're on to a real role for them. I think I've even found a potential mechanism, but then again, I am an optimist. It's currently part of a so far unsuccessful grant application, so don't hold your breath on actually seeing it. Here's another that talks about them more generally. (That link may or may not work; the reference is Pediatr Emerg Care. 2004 Sep;20(9):636-40.) The first two studies are on PubmedCentral, so they're free. If you have Ovid access, you can get the last one, I think.

I'm looking at Veionella sp and Prevotella sp because we have the clinical isolates (pain in the ASS to grow, but I have them), and because aspects of their biology make them look particularly suspicious.

User avatar
oxoiron
Posts: 1365
Joined: Fri Jul 13, 2007 4:56 pm UTC

Re: Research

Postby oxoiron » Mon Aug 18, 2008 4:27 pm UTC

I study bioinorganic iron-oxygen chemistry. This means I also look at a fair amount of Mn, Co and Cu chemistry, too. Currently, I am interested in oxygen activation by diiron systems. I synthesize biomemetic complexes in attempts to get a better understanding of what chemistry is really taking place in the enzyme(s) I'm trying to mimic.
telcontar42 wrote:Right now I'm at Brookhaven National Labratory using the synchotron light source here...
That's too bad. BNL sucks. The lines at Stanford are much better, not to mention the ambience. Next time you apply for beam time, try to get time at SSRL.
"Whenever you find yourself on the side of the majority, it is time to reform (or pause and reflect)."-- Mark Twain
"There is not more dedicated criminal than a group of children."--addams

User avatar
hipp5
Posts: 321
Joined: Tue Oct 30, 2007 4:05 am UTC
Location: Kingston, ON

Re: Research

Postby hipp5 » Mon Aug 18, 2008 11:09 pm UTC

This fall I start my undergrad thesis. It's in paleolymnology and I'll probably be looking at copepods in core samples to sketch out past environmental trends. I think it's going to be a lot of long hours in a lab looking through a microscope but it should be interesting and there's a good chance of me getting published. Also, my supervisor was just named Canadian Environmentalist of the Year so that's pretty cool.

masher
Posts: 821
Joined: Tue Oct 23, 2007 11:07 pm UTC
Location: Melbourne, Australia

Re: Research

Postby masher » Mon Aug 18, 2008 11:33 pm UTC

telcontar42 wrote:Right now I'm at Brookhaven National Labratory using the synchotron light source here (that's why I'm working at 4 in the morning, we only have limited time to use this equipment, I don't usually work through the night). It's pretty cool to be working with an accelerator, even if I'm just using one of the many beam lines off of it.


What beamline are(were) you on? I don't know anyone that works there, but I do know a couple of people that have beem to Brookhaven.

I spend a bit of time at the Australian Synchrotron on the diffraction beamline look at the dissolution of minerals in-situ. Yay for dissolving dirt in caustic at 200ºC!

User avatar
telcontar42
Posts: 430
Joined: Sat Jun 28, 2008 10:33 pm UTC
Location: Davis, CA
Contact:

Re: Research

Postby telcontar42 » Tue Aug 19, 2008 1:03 am UTC


User avatar
Dez1013
Posts: 1
Joined: Tue Aug 19, 2008 8:29 pm UTC

Re: Research

Postby Dez1013 » Tue Aug 19, 2008 8:40 pm UTC

I have completed my graduate studies but have done research since my second week of entering college. I'm a chemist and started off making nickel Schiff base compounds for ethylene polymerization. We also modeled these with so low level calculations, looking at predicted geometries and such.

My graduate research based on synthesizing chiral alpha-hydroxy phosphonates as chiral building blocks for the stereocontrolled synthesis of THF rings which are quite common in natural products, specifically I was applying this to Amphidinolide C.

Thats mainly what I did, also did a lot of chiral separations on GC and HPLC, mechanism studies by NMR, and lots and lots of chiral catalysis.

User avatar
Fledermen64
Posts: 428
Joined: Thu Feb 14, 2008 9:29 pm UTC

Re: Research

Postby Fledermen64 » Tue Aug 19, 2008 10:21 pm UTC

I have a question. Im going into my sophomore year for an EE degree. Im not sure if i want to go for a PhD and i was wondering weather it would be better to look for research opportunity's at the school or to look for an internship. Or is there something else im missing.
"I just want to say before I do this that I have no idea what I'm doing and I love you all very dearly. Ok lets light this bitch and hope for the best"
-Myself before a homemade 4th of July fireworks extravaganza

crowey
That's DOCTOR Crowey, to you
Posts: 1603
Joined: Wed Feb 20, 2008 10:52 pm UTC
Location: UK

Re: Research

Postby crowey » Thu Aug 21, 2008 12:02 am UTC

I'm another biologist: halfway through a PhD in behaviour genetics at Uni of Exeter in Cornwall (UK)

Looking for controlling genes in the switch from killing to caring (and back again) in burying beetles (Nicrophorus vespilloides).
It's pretty awesome, these beetles go from killing anything they come accross to caring for (seriously, like, they make a nest and regurgitate food) anything larvae-like they come accross, wrong species and everything! And it's at a very se scedule from discovering a carcass to breed on to the switch. It's already been shown to be (very likely) genetically controlled, and photoperiod effects the timing, so we figure the circadian clock is co-opted somehow.

I get to do some cool things, like 454 and solexa sequencing, and hopefully RNAi (if I have time). Currently I'm focusing on getting candidate genes- things like For and the circadian genes seem to be good calls, and Fax is worth a punt too.

I *almost* have a result :roll: Hopefully the sequecing will show that I was amazing and my boss was wrong, but we'll see :wink:

User avatar
MillerTime
Posts: 12
Joined: Sun Aug 03, 2008 2:46 pm UTC
Location: Nebraska

Re: Research

Postby MillerTime » Wed Sep 03, 2008 12:44 pm UTC

Spudgun wrote:
MillerTime wrote:I'm currently an undergrad doing some research on the plasticity of the gustatory system of rats, specifically looking at the differences of creating lesions on neonatal rat pups versus older rats. Basically we take several rats that are <10 days old and create a lesion on their chorda tympani nerves and follow up with cell body counts on the chorda tympani with groups of 2-3 at different ages (group 1 will age to 15 days, 2 will age to 30, 3 to 45... ect.) and we also count taste buds on the tongue surface and note the unusual taste bud structures that arise from a tongue with lesions. We do most of the counting with either a confocal microscope or the TEM. For the most part I get to profuse the rats and count the cell bodies, the grad student is more of the brains and I get to hang along and learn all sorts of fun things. Also confocal and electron microscopy are amazing.


That sounds like some interesting research, do you mind telling me what your major is?


I'm a biology undergrad, and I now have an opportunity to lead my own study about foliate papillae. Foliate papillae are taste buds that run along the side of tongues and rats have a few near the backs of their tongue. We'll do about the same general procedure as for fungiform papillae with the chorda tympani cutting but I'll have to do all the research and submitting to IACAUC and that fun stuff, I'm pretty stoked.
"I'm sciencing as fast as I can!" -Hubert J. Farnsworth-
"The world is a mess... and I just need to rule it." -Dr. Horrible-

User avatar
meat.paste
Posts: 404
Joined: Fri Apr 25, 2008 3:08 pm UTC

Re: Research

Postby meat.paste » Wed Sep 03, 2008 6:30 pm UTC

I'm a scientist / engineer. My undergraduate and graduate work was spent on building mass spectrometers and using them in novel ways. My current industry job is along the same lines.

At the moment, it means I am investigating why some ceramics have desirable characteristics, and some don't. It involves some guesses through the chemistry, research in the literature and on artists use of ceramics, and a lot of waiting on a vendor to make me some samples to test. Making instrumentation will touch on many different fields at a time.
Huh? What?

RabidAltruism
Posts: 135
Joined: Fri Aug 29, 2008 9:25 pm UTC

Re: Research

Postby RabidAltruism » Thu Sep 04, 2008 2:34 am UTC

Undergrad Psychology and Mathematical Economics major here. This semester I've proposed/am awaiting IRB approval on an experiment aimed at better understanding a specific learning (Herrnstein's Matching Law -- Rocko knows quite a bit about it as well) rule popular/successful in a wide variety of experimental settings; I'm also extremely interested in learning rules generally, and in incorporating them into social situations ala game theory, but working sociality into a learning experiment of my own is on the back-burner for now. Maybe next semester.
...she reminds you of the invisible form of the soul; she gives life to her own discoveries; she awakens the mind and purifies the intellect; she brings light to our intrinsic ideas; she abolishes oblivion and ignorance which are ours by birth...

User avatar
Mr. Samsa
Posts: 144
Joined: Thu Sep 20, 2007 11:14 pm UTC
Location: Down south.

Re: Research

Postby Mr. Samsa » Sun Sep 07, 2008 10:13 am UTC

RabidAltruism, that sounds like it could be pretty interesting. Sorry to be nosy, but what in particular are you hoping to understand better about the matching law and how are you planning on doing this?

User avatar
lesliesage
Posts: 1729
Joined: Thu May 31, 2007 8:07 pm UTC
Location: Washington, DC
Contact:

Re: Research

Postby lesliesage » Sun Sep 07, 2008 4:30 pm UTC

On Thursday I met Ole Peterson! He was the first note K+ Na+ Cl- co-transport!

I'm doing a PhD in physiology- stuff about microcirculation. Namely, the glycocalyx and its contribution to microvessel regulation of permeability.

RabidAltruism
Posts: 135
Joined: Fri Aug 29, 2008 9:25 pm UTC

Re: Research

Postby RabidAltruism » Mon Sep 08, 2008 9:56 pm UTC

Hey Samsa,

No worries -- I'd have explained at more length, but I usually overdo it when I do, and figured if anyone was interested they could ask. So, that worked out. :P

The Matching Law's success has been in predicting that a person or animal with a given set of alternatives (it has not to my knowledge been generalized to a continuous series of options, though I'd like to do that, too, and I don't think it should be too very difficult, so think discrete -- 1, 2, 3 options are normal, with situations with only 1 option actually being interpreted as 1 option with the alternative being to just sit there and relax) will, over a significant period of choosing between those options repeatedly, come to choose each option for a percentage of the 'time' (or number of choices, or some similar measure) that equals the percentage of 'reward' (denominated in some homogeneous unit, ala money, food pellets, electrical brain stimulation (a series of lesioning studies with rats, iirc)), etc., though a few authors have compared different units.

The usual Matching Law experiment aimed at distinguishing 'matching behavior' from maximizing behavior, and systematically so. Because of that, though, most researchers didn't make strong attempts to examine ambiguities in the Matching Law's predictions; one of those ambiguities, and the one I'll be testing this semester, is what happens when a given experiment by nature allows its participants multiple frequencies of choices that could be called 'matching behavior.'

There's a little bit more to it, but that's the most important part; it's an issue analogous to multiple equilibria problems in various systems, but instead of dealing with potental energy or Nash Equilibria, the stability issues here are at the behavioral level. I'm curious what might predict which Matching equilibrium folks end up operating at -- or if the distribution is uniform-random, or whether multiple equilbirium points somehow actually stops people from 'matching' at all (which would be a significant exception to the findings in the rest of this body of work, despite its being an essentially negative finding).
...she reminds you of the invisible form of the soul; she gives life to her own discoveries; she awakens the mind and purifies the intellect; she brings light to our intrinsic ideas; she abolishes oblivion and ignorance which are ours by birth...

SU3SU2U1
Posts: 396
Joined: Sun Nov 25, 2007 4:15 am UTC

Re: Research

Postby SU3SU2U1 » Mon Sep 08, 2008 10:10 pm UTC

hitokiriilh wrote:Lately I've been toying around with eliminating the use of particles (classically) and formulating the theories in terms of just the fields the particles generate....


This is essentially all that modern physics (in the quantum field theory sense) does- everything is dealt with in terms of fields and particles only show up when you quantize. I'm confused as to what you are trying to do? Are you trying to remove fermion fields in favor of bosonic fields (no electrons, just e/m fields, etc?) If this is the case, why the preference for bosonic over fermionic fields?

3) Apparently quantum mechanics and special relativity haven't been proven to be mathematically consistent in 4+ dimensions (A. Jaffe managed to show they are in 2 and 3 dimensions, but particle physicists have just been making the assumption for 4+ for the last 60 years).


In what sense? Certainly I can write down a Lagrangian with a Lorentz symmetry and quantize it in any number of dimensions.

nonetheless if the particle terms from a Langrangian are eliminated, so are the interaction terms


I don't think this is true. For abelian fields like photon fields yes, but practically any other gauge field has self interactions (gluon fields carry color and so interact with gluon fields. Gravitational fields have mass/energy and so react with mass/energy, etc).
-Will

ossix
Posts: 25
Joined: Sat Mar 08, 2008 12:36 pm UTC

Re: Research

Postby ossix » Mon Sep 08, 2008 10:55 pm UTC

i'm a physics/CS student just starting into my second year.
I'm currently working on an algorithm to improve the human perceived signal/noise ratio in high-stress intercom appliances.
it's not part of my university studies (i'm doing it "for fun and if it turns out to work profit"), although my profs really are helpful when i ask some weird questions about signal processing ^^

User avatar
Mr. Samsa
Posts: 144
Joined: Thu Sep 20, 2007 11:14 pm UTC
Location: Down south.

Re: Research

Postby Mr. Samsa » Tue Sep 09, 2008 3:09 am UTC

RabidAltruism, I'm feeling a bit dense today so I apologise in advance for any stupid questions which may follow. I also assume that you've done a fair amount of background reading on your topic so sorry again if I ask something which you've already realised and taken into account.
Spoiler:
it has not to my knowledge been generalized to a continuous series of options, though I'd like to do that, too, and I don't think it should be too very difficult, so think discrete -- 1, 2, 3 options are normal, with situations with only 1 option actually being interpreted as 1 option with the alternative being to just sit there and relax


1)Do you mind if I ask which matching law you're using? I'm guessing you're using the generalised matching law rather than strict matching, right? (I'm sorry if that seems like a pointless question to ask, but I've found that when dealing with human 'subjects' researchers just tend to use strict matching as it's the easiest).

2)By a 'continuous series of options' do you mean something like a chain schedule? Or did you mean to have all 3 options available at the same time in a concurrent setup? If it's the latter, then won't the 3rd option essentially be irrelevant (in regards to affecting the matching law) since the constant ratio rule suggests that the ratio between two alternatives remains constant even when a 3rd (such as the extraneous reinforcers you mentioned) alternative is introduced?

what happens when a given experiment by nature allows its participants multiple frequencies of choices that could be called 'matching behavior.'


Sorry, I had a lot of trouble understanding the most important part of your post (due to my faults, not yours)..

3)Firstly, I assume that the 'experiment by nature' part was referring to the nature of experiments, and not an experiment in a natural setting, right? Or is this an experiment in behavioural economics using an open-economy?

4)Could you give me an example of what you mean by 'multiple frequencies of choices' please? I'm failing to fully wrap my head around it, sorry. From the way I read it, it sounds like you're essentially testing the theory of melioration as the mechanism for matching, is that close?

5)And how are you measuring whether a subject is matching or not? I assume you'll be looking at sensitivity to reinforcement? At what level would you expect the sensitivity to drop to if matching is no longer happening?

Sorry again for my denseness and if I sounded like I was attacking you or your research, it's just a wonderful combination of my (lack of) communication skills coupled with active interest. :D


Spoilered for length so as not to derail thread..

User avatar
iamfree
Posts: 121
Joined: Fri Feb 29, 2008 5:11 pm UTC
Location: Virginia

Re: Research

Postby iamfree » Wed Sep 10, 2008 5:06 pm UTC

I love all of the biology research woot.

I do research in a breeding program for oysters native to Chesapeake Bay (C. virginica). We breed for disease resistance (mainly from MSX and Dermo) as well as improved growth/meat quality. Part of our mission is to provide the seafood industries around the bay with higher quality broodstock for them to spawn and grow out as well as producing animals that can be used for restoration projects. Mostly we use selection to improve these factors. Recently we've been experimenting with polyploidy, namely triploidy, to get the results we are looking for. This polyploidy research will be my area of study next year when I start my quest for a master's degree from william and mary
GACAACGCACGCAACGCGCCCCGGACCACCUAA

just let It happen


Return to “Science”

Who is online

Users browsing this forum: No registered users and 125 guests