What is "patriotism"?

For the serious discussion of weighty matters and worldly issues. No off-topic posts allowed.

Moderators: Azrael, Moderators General, Prelates

User avatar
Sour Apple
Posts: 231
Joined: Tue Feb 26, 2008 12:17 am UTC
Location: USA
Contact:

What is "patriotism"?

Postby Sour Apple » Tue Mar 11, 2008 7:45 pm UTC

This post started as a response to someone else, but it turned into a rant and I want to hear others' thoughts on the matter.

Lumpy wrote:Having been a soldier may not indicate quality as a leader, but it makes that politician immune from "You heartless bastard, sending them to their deaths! You don't know what it's like on the ground!" argument made against Bush and the company he keeps around him. It also makes them immune to those "not patriotic" e-mails that fly around periodically.


It is a dangerous and tragic thing that, in the US today, patriotism is equated with getting involved in foreign wars... What is being a patriot now, anyway? I thought it meant being a good American citizen-- not forcing everyone else in the whole fucking world to be a good American citizen. People mistake oppression for patriotism, and patriotism for ideals. If people are going to interfere in other countries' business, they shouldn't be allowed to call that patriotism. I mean, since when does loyalty to one's country and its Constitution extend to fighting other peoples' battles?

Being a soldier doesn't automatically make you patriotic. In fact, if you were to be a real patriot, you'd stay at home with your shotgun and make sure that no one and nothing could harm your patria, ex., the US. Wouldn't you? Because if you're off fighting a war in the Middle East, you're not here in case Canada invades or something. [Spoiler'd for hateful rant.]
Spoiler:
You: dats why wer in iraq, durr! b/c they invadd us
Me: Oh, really? So attacking an entire country is going to save us from a specialized group of terrorists and non-existent non-launched WMDs? And, oh, what about those army bases in half the countries in Asia? Right, right, spreading democracy. Whatever. You're not a patriot."

Also, overheard in poli-sci, during our study of the Constitution. I swear to Allah. This made me want to shoot myself in the face.

Chick: So, like, if we are Constitutionally allowed to defend our country, and we're defending ourselves against terrorists in Iraq, why don't we just put bases in every country to make sure that we don't get attacked? Isn't it our right to protect our country with a pre-emptive attack?

[Bee-tee-dub, I checked her face for facetiousness. There was none. Not a trace.]

Oh. My. FUCKING. FUCK. If we didn't have enemies before this [which we do], we certainly will after she gets elected to office. Please, someone, get an un-Constitutionally difficult-to-obtain and gun license and shoot me in the face.

So, really, what do you all think patriotism means? If you give me a dictionary definition, fine, but expand on that with personal thoughts and interpretations. As a libertarian, I have to say I'd go with the simplest of patriotism: make sure that nothing gets in the way of man's natural rights and defend the Constitution as it was originally intended.
Who I am. [Apparently this isn't obvious: I'm a chick, a bird, a female of your species.]

User avatar
iamfree
Posts: 121
Joined: Fri Feb 29, 2008 5:11 pm UTC
Location: Virginia

Re: What is "patriotism"?

Postby iamfree » Tue Mar 11, 2008 7:59 pm UTC

I didn't want to get involved in these types of threads but alas, I have jumped in head first.

To start off with I am more or less a Libertarian socialist.

Sour Apple wrote:make sure that nothing gets in the way of man's natural rights and defend the Constitution as it was originally intended.

I agree with the first part "make sure that nothing gets in the way of man's natural rights" but I will have to disagree about defending the Constitution's original intent. Ideals were different then and we should adapt as a result of that. I just read another thread that someone posted a semi-off topic link to a article called "What You Can't Say". If you haven't read it I suggest you do so. You can apply the method of thinking from this article with the evolution of morals and that is the reason why I sincerely hope we don't hold 100% with whatever original intent we assume the constitution had. (Let alone the fact that the original intent has to be perceived by someone (which in itself skews the meaning)).
GACAACGCACGCAACGCGCCCCGGACCACCUAA

just let It happen

User avatar
Sour Apple
Posts: 231
Joined: Tue Feb 26, 2008 12:17 am UTC
Location: USA
Contact:

Re: What is "patriotism"?

Postby Sour Apple » Tue Mar 11, 2008 8:39 pm UTC

What ideals have changed? Have natural rights changed? Yes, circumstances have changed in regards to the situation of slavery and women, but have things like freedom of speech and a balanced system really gotten old-fashioned? I don't think so. I meant those two phrases to be synonymous-- the original intent of the Constitution was to defend the natural rights of citizens.
Who I am. [Apparently this isn't obvious: I'm a chick, a bird, a female of your species.]

zenten
Posts: 3799
Joined: Fri Jun 22, 2007 7:42 am UTC
Location: Ottawa, Canada

Re: What is "patriotism"?

Postby zenten » Tue Mar 11, 2008 8:44 pm UTC

I've seen two uses. There's the positive one where patriotism is liking your country, and doing what you can to preserve it. Then there's the negative one, where you blindly follow the country, and treat it as more important than a person.

User avatar
Mighty Jalapeno
Inne Juste 7 Dayes I Wille Make You A Hero!
Posts: 11265
Joined: Mon May 07, 2007 9:16 pm UTC
Location: Prince George In A Can
Contact:

Re: What is "patriotism"?

Postby Mighty Jalapeno » Tue Mar 11, 2008 8:50 pm UTC

zenten wrote:I've seen two uses. There's the positive one where patriotism is liking your country, and doing what you can to preserve it. Then there's the negative one, where you blindly follow the country, and treat it as more important than a person.

Mod parent up.

Seriously, that was 99% of what I wanted to say. Perhaps the power of the Wiki can help me...

He is a poor patriot whose patriotism does not enable him to understand how all men everywhere feel about their altars and their hearthstones, their flag and their fatherland. * Harry Emerson Fosdick

Conceit, arrogance, and egotism are the essentials of patriotism. [...] Patriotism assumes that our globe is divided into little spots, each one surrounded by an iron gate. Those who have had the fortune of being born on some particular spot, consider themselves better, nobler, grander, more intelligent than the living beings inhabiting any other spot. It is, therefore, the duty of everyone living on that chosen spot to fight, kill, and die in the attempt to impose his superiority upon all the others. * Emma Goldman,

The pamphlet was very patriotic. That is, it talked about killing foreigners. * Terry Pratchett

To me, it seems a dreadful indignity to have a soul controlled by geography. * George Santayana

Patriotism is your conviction that this country is superior to all other countries because you were born in it. o George Bernard Shaw

DougP
Posts: 42
Joined: Sun Feb 03, 2008 6:03 am UTC

Re: What is "patriotism"?

Postby DougP » Tue Mar 11, 2008 9:39 pm UTC

Patriotism, as far as I am concerned, is synonymous with nationalism, that sounds a bit nicer. That is to say, it is the belief that your country is better than others, for whatever reason. It is dangerous, in my opinion, because it implies an air of superiority over other people from other places, without any reason.

User avatar
Thadlerian
Posts: 336
Joined: Tue Mar 11, 2008 7:58 pm UTC
Location: Norway

Re: What is "patriotism"?

Postby Thadlerian » Tue Mar 11, 2008 10:01 pm UTC

The discussion so far seems to be mainly concerning subjective definitions of "patriotism". So I think I'll fill in a more objective approach.

Patriotism is institutionalized nationalism. That's what I read in some book (was is Imagined Communities? Don't remember), and it makes sense to me.

Nationalism is to make nationality a base for your identity. To relate to a group of people you mostly don't know, on the idea that living some particular place, looking like some particular something, having some particular traditions or just simply being different from some particular other people produces an essential, tangible bond between you. Don't get me started. I took an anthropology course that aimed to define ethnicity and nationalism. Holy macaroni, what a mess!

Anyway, patriotism is when you take this stuff a step further. It's when you accept the legitimacy of a state/political system that represents this national bonding. It is usually elected, but need not necessarily be.

For instance, joining the military because you feel it is expected of you by other people than just your closest friends and relatives, would be an act of patriotism.

Also, you could say that patriotism is nationalism going directly conscious. An elderly couple living in the countryside, isolated except through radio (and TV) could still be considered nationalists, even if they never act for their country's good, by, for instance, the way they react to foreigners. But patriotism requires you to consciously be aware of your country.

Patriotism also tends to focus around abstract concepts, like symbols, but is, ultimately, about accepting nationality to be pushed into a tangible structure.

One final point: Patriotism/nationalism cannot exist without the perception of Others. Inherent to the idea of patriotism is the idea of the others as a constant threat, because your loyalty is required as a counter to the potential danger they represent. I don't know how Americans relate to patriotism, as with the way it is weaved into culture and tradition, but patriotism without the Others is not patriotism. It is more like a religion, with the national symbols and concepts filling some of the fuctions of a god.

Another final point: As for patriotism promoting a sense of superiority (and therefore being dangerous), I tend to agree. I think experiments on group behaviour (like Tajfel and Turner) indicates something directly like that; that groups automatically become competitive and potentially mutually hostile. But I can't remember precisely, nor do I know if that tendency can be safely considered a fact in the large-scale sense of patriotism. Anyway, feelings of superiority would soon arise anyway, through conscious socialization efforts by the state, movements and individual activists.

Bluecold
Posts: 53
Joined: Sat Oct 20, 2007 1:13 pm UTC

Re: What is "patriotism"?

Postby Bluecold » Tue Mar 11, 2008 10:28 pm UTC

Patriotism is the thing which the left says the right lacks and the right says the left lacks.
It's a bit like "respect" insofar as it doesn't mean anything anymore due to over-/wrong usage.

User avatar
Mighty Jalapeno
Inne Juste 7 Dayes I Wille Make You A Hero!
Posts: 11265
Joined: Mon May 07, 2007 9:16 pm UTC
Location: Prince George In A Can
Contact:

Re: What is "patriotism"?

Postby Mighty Jalapeno » Tue Mar 11, 2008 10:32 pm UTC

Patriotism is when people say "My country, right or wrong", mean it, and don't see the problem.

User avatar
iamfree
Posts: 121
Joined: Fri Feb 29, 2008 5:11 pm UTC
Location: Virginia

Re: What is "patriotism"?

Postby iamfree » Wed Mar 12, 2008 1:13 am UTC

DougP wrote:Patriotism, as far as I am concerned, is synonymous with nationalism, that sounds a bit nicer. That is to say, it is the belief that your country is better than others, for whatever reason. It is dangerous, in my opinion, because it implies an air of superiority over other people from other places, without any reason.



BINGO DougP
GACAACGCACGCAACGCGCCCCGGACCACCUAA

just let It happen

User avatar
Dream
WINNING
Posts: 4338
Joined: Tue Dec 04, 2007 7:20 pm UTC
Location: The Hollow Scene Epic

Re: What is "patriotism"?

Postby Dream » Wed Mar 12, 2008 2:53 am UTC

Mighty Jalapeno wrote:Patriotism is when people say "My country, right or wrong", mean it, and don't see the problem.
Perhaps this is why Oscar Wilde called it "The virtue of the vicious"...

I don't approve of patriotism, simply because I'm currently living the benefits of two countries (Ireland and the United Kingdom) not putting their own pride and narrow self interest ahead of all else. I'm not saying that patriotism in necessarily prideful and selfish, but I do think it promotes such attitudes, and that those attitudes are unhelpful. I think that in the aftermath of WWII, most of Europe got over the idea that their country is better off thinking and acting like it is better than everyone else's, and Europe is so much the better for that attitude. Now we are all at peace for the first time in millennia, and I ascribe that in a large part to European citizen's abilities to look beyond blinkered patriotism.
I knew a woman once, but she died soon after.

Herman
Posts: 559
Joined: Wed May 02, 2007 2:46 am UTC

Re: What is "patriotism"?

Postby Herman » Wed Mar 12, 2008 3:52 am UTC

I think there's more to patriotism than that. There's an element of preference for your own country over others, but that's not necessarily a bad thing. Parents are expected to have a preference for the well-being of their own children over others. A parent who cared about their own children exactly as much as every other child in the world would be considered a subpar parent. Only to an extent of course; you spend a lot of resources on your own kid and not others, but you don't go actively harming other kids. Patriotism is similar. A patriotic person loves her country, and works to improve it, perhaps more than she cares about other countries. Which is partly just because it's practical -- your country is where you live; you can't perform a civil service for Russia very easily if you live in Brazil. Again, the preference shouldn't be absolute, but it's okay that it's there to an extent. Patriotism can get out of control, and then of course it's not good anymore. Just like anything else.

There's an element of "No True Scotsman (ha!)" here, I realize, but I think it's possible to be a "good patriot," without all the negative behaviors the other posters are bringing up.

User avatar
Adalwolf
Posts: 557
Joined: Thu Nov 29, 2007 3:05 pm UTC

Re: What is "patriotism"?

Postby Adalwolf » Wed Mar 12, 2008 4:15 am UTC

Patriotism and Nationalism are NOT the same.

Patriotism is a love for ones country. A patriot would want to defend his country from aggression, corruption, and want to improve it. Patriots can recognize that something is wrong in the nation, and work to change it for the better.

Nationalism is the belief that your country is superior to all others countries.

There is nothing wrong with patriotism, and frankly, I've never found nationalism to be much of a problem unless taken to extremes.
Live with passion. Die with passion.

User avatar
Ari
Posts: 725
Joined: Sun Oct 07, 2007 5:09 pm UTC
Location: Wellington, New Zealand

Re: What is "patriotism"?

Postby Ari » Wed Mar 12, 2008 11:51 am UTC

DougP wrote:Patriotism, as far as I am concerned, is synonymous with nationalism, that sounds a bit nicer. That is to say, it is the belief that your country is better than others, for whatever reason. It is dangerous, in my opinion, because it implies an air of superiority over other people from other places, without any reason.


I'd disagree in general, but I don't disagree that's the way the term is used in America. True Patriotism to me is the desire to advance your own country, or pride/affection for your own country- expressed perhaps by protecting it, perhaps by fighting corruption, perhaps by making it wealthier, perhaps by making it smarter, and so on.

Like all descriptive terms, it has a good side and a bad side. Protecting and aiding your fellow citizens, recognising the good things about your country, keeping your country independent, advancing your national culture, and so on, all describe the good side of patriotism.

There is the bad side too: taking pride in unwarranted aggression against other countries, defending corrupt institutions or individuals just because they are seen as objects of patriotism, fighting the social justice that can be provided by otherwise desirable globalisation, marginalising other nations' cultures and losing tolerance, distaste for pluralism, and of course, the attempt to peer-pressure people into any of those other bad expressions of patriotism in some sort of false-dichotomy.
"Hey %*&^er, offensive communication works fine so long as you do it respectfully." :D
"I am so quoting that out of context at a later date."

User avatar
aseroto
Posts: 10
Joined: Tue Mar 11, 2008 11:22 am UTC

Re: What is "patriotism"?

Postby aseroto » Wed Mar 12, 2008 12:53 pm UTC

Good ol Wikipedia

Patriotism denotes positive and supportive attitudes to a 'fatherland' (Latin patria < Greek patris, πατρίς), by individuals and groups. The 'fatherland' (or 'motherland') can be a region or a city, but patriotism usually applies to a nation and/or a nation-state. Patriotism covers such attitudes as: pride in its achievements and culture, the desire to preserve its character and the basis of the culture, and identification with other members of the nation. Patriotism is closely associated with nationalism, and the terms are often used synonymously. Strictly speaking, nationalism is an ideology - but it often promotes patriotic attitudes as desirable and appropriate. (Both nationalist political movements, and patriotic expression, may, yet need not, be negative towards other people's 'fatherland').

Patriotism has ethical connotations: it implies that the 'fatherland' (however defined) is a moral standard or moral value in itself. The expression my country right or wrong—perhaps a misquotation of the American naval officer Stephen Decatur, but also attributed to Carl Schurz—is the extreme form of this belief. Patriotism also implies that the individual should place the interests of the nation above their personal and group interests. In wartime, the sacrifice may extend to their own life. Death in battle for the fatherland is the archetype of extreme patriotism.


My country as a moral value? What a novel idea!

Wiki again
Moral values are things held to be right or wrong or desirable or undesirable. While morality is sometimes described as 'innate' in humans, the scientific view is that a capacity for morality is genetically determined in us[citation needed], but the set of moral values is acquired, through example, teaching, and imprinting from parents and society. Different cultures have very different moral value systems. Moral values, along with traditions, laws, behaviour patterns, and beliefs, are the defining features of a culture.

In Evolutionary psychology, moral values are seen as part of cultural evolution. Nationalists believe that a society needs one set of values to hold it together, and that 'multiculturalism' is not desirable as it tends to lead to conflict. People with shared values reduce conflict within a group and make reciprocal altruism possible. Diverse interests is one mechanism promoting the 'Tragedy of the commons', in which individuals pursuing their own interests exhaust resources that could be collectively managed.

Moral values are enforced by example, parenting, peer guidance, conscience, disapproval, shunning, and only in some instances by law. They were effective in small communities before laws were formalised. They can also be sustained by the concept of 'status', a concept which has many different meanings in different societies. There is today significant disagreement over what role status plays in contemporary society and of what it actually consists.


That's patriotism if each country is a metaphor for an individual.

In other words, patriotism in its current state is a major factor dragging the human race back from true advancement.
Also, I have nothing original to contribute.
Spoiler:
shoo

User avatar
Dream
WINNING
Posts: 4338
Joined: Tue Dec 04, 2007 7:20 pm UTC
Location: The Hollow Scene Epic

Re: What is "patriotism"?

Postby Dream » Wed Mar 12, 2008 1:01 pm UTC

Adalwolf wrote:Nationalism is the belief that your country is superior to all others countries.


Sorry, not even close. Nationalism is the belief that some definable set of people, normally geographically and culturally distinct, but not always, and occasionally ethnically distinct have an inherent right to self determination. There is nothing about superiority involved, and it is quite possible be a nationalist who thinks their country is inferior in almost every way.

If superiority comes into it, then the nationalism has already been taken to an extreme, because anyone claiming to be a nationalist should surely understand and support that claim in other nations, and realise that the "superior" view is entirely subjective. If in spite of this they still believe they are superior, then they are hardly nationalists at all, more like what in Europe is commonly called ultra-nationalist.

I have as little love for nationalists as I do for "patriots" (although I agree with various posters above who say that moderate positive patriotism can be a good thing), as I have seen the damage nationalism can do, and the great benefits of putting it aside and realising that many countries share much more than they differ. I'm eternally greatful to be able to consider myself "European" instead of just "Irish".
I knew a woman once, but she died soon after.

drbhoneydew
Posts: 34
Joined: Tue Jan 15, 2008 4:10 pm UTC

Re: What is "patriotism"?

Postby drbhoneydew » Wed Mar 12, 2008 4:22 pm UTC

Patriotism is one of those words that when someone describes themself as such I instantly go into "pinch of salt" mode. A bit like sentences that start with "I'm not [racist|sexist|something] but..."
I think Ari hit the nail on the head with regards the good/bad side; it is my experience that good patriots tend to keep quiet about it, which is why people tend to associate the concept in a negative light.

User avatar
Akula
Posts: 619
Joined: Thu Feb 01, 2007 7:55 pm UTC
Location: Vermont
Contact:

Re: What is "patriotism"?

Postby Akula » Wed Mar 12, 2008 5:48 pm UTC

To me, patriotism is taking pride in your countries achievements, and being ashamed of it's failures.

I think Mark Twain epitomized this.
"I never let my schooling interfere with my education" - Mark Twain

User avatar
segmentation fault
Posts: 1770
Joined: Wed Dec 05, 2007 4:10 pm UTC
Location: Nu Jersey
Contact:

Re: What is "patriotism"?

Postby segmentation fault » Wed Mar 12, 2008 7:50 pm UTC

i think the majority define patriotism as supporting your country and its leaders regardless of how stupid their decisions are.

they would be wrong.

patriotism is a love and devotion to ones country. but to love something means its okay to criticize it to make it better imo.
people are like LDL cholesterol for the internet

Silas
Posts: 1091
Joined: Sat Feb 02, 2008 9:08 pm UTC

Re: What is "patriotism"?

Postby Silas » Wed Mar 12, 2008 8:07 pm UTC

I'm surprised by all the controversy here... oh, wait, it's just people who don't like the idea of nationalism hating on those that do. And a little bit of vice versa.

Patriotism is very simple: it's putting your nation's (patria, Latin) interests above your own. It's being a team player, when the 'team' is the nation, or being a family man (or company man, for that matter), but with the family (or company) replaced with the nation.

It's closely related to (but not the same as) nationalism: the belief that nations are a relevant frame of reference for evaluating us-or-them situations.

As for all the examples anyone can bring up for (usually right-wing) people using patriotism as a club to bludgeon their political adversaries, it's no more or less "true" than when (usually left-wing) people use callousness and 'being in the pocket of big Oil' as a club to bludgeon their own political adversaries. It's not that the concept has no merit, it's that it's being used disingenuously to make guilt-by-association pleas.
Felstaff wrote:Serves you goddamned right. I hope you're happy, Cake Ruiner

DougP
Posts: 42
Joined: Sun Feb 03, 2008 6:03 am UTC

Re: What is "patriotism"?

Postby DougP » Wed Mar 12, 2008 8:14 pm UTC

Silas wrote:
Patriotism is very simple: it's putting your nation's (patria, Latin) interests above your own. It's being a team player, when the 'team' is the nation, or being a family man (or company man, for that matter), but with the family (or company) replaced with the nation.

It's closely related to (but not the same as) nationalism: the belief that nations are a relevant frame of reference for evaluating us-or-them situations.


Your definition of nationalism is implicit in your definition of patriotism. In defining "your nation's interests" you are already defining and us v. them situation. And not in opposition to your own interests, like you have defined it, but in relation to the interests of other countries. That is the inherent problem, in my opinion.

User avatar
Mighty Jalapeno
Inne Juste 7 Dayes I Wille Make You A Hero!
Posts: 11265
Joined: Mon May 07, 2007 9:16 pm UTC
Location: Prince George In A Can
Contact:

Re: What is "patriotism"?

Postby Mighty Jalapeno » Wed Mar 12, 2008 8:23 pm UTC

DougP wrote:
Silas wrote:Patriotism is very simple: it's putting your nation's (patria, Latin) interests above your own. It's being a team player, when the 'team' is the nation, or being a family man (or company man, for that matter), but with the family (or company) replaced with the nation.

It's closely related to (but not the same as) nationalism: the belief that nations are a relevant frame of reference for evaluating us-or-them situations.

Your definition of nationalism is implicit in your definition of patriotism. In defining "your nation's interests" you are already defining and us v. them situation. And not in opposition to your own interests, like you have defined it, but in relation to the interests of other countries. That is the inherent problem, in my opinion.

I do not put Canada's interests above my own, but take them into consideration when I am doing things which may AFFECT Canada. I am not inherently proud to be Canadian.... my parents fucked here, I didn't have much say in it. However, I have learned to be proud of many aspects of what this country has done, in terms of policy and action, both domestic and abroad. I've acquired a sense of respect. I am not patriotic, or nationalistic, insofar as those words can be defined any way used here.

Silas
Posts: 1091
Joined: Sat Feb 02, 2008 9:08 pm UTC

Re: What is "patriotism"?

Postby Silas » Wed Mar 12, 2008 9:21 pm UTC

I didn't phrase it well, earlier, when I wrote,
Silas wrote:nationalism: the belief that nations are a relevant frame of reference for evaluating us-or-them situations.

I mean more that identifying with a nation- saying "we" do or did or are this or that or the other thing- is what makes nationalism.

DougP wrote:Your definition of nationalism is implicit in your definition of patriotism.
Well, yes, but I figured it couldn't hurt to spell it out.
In defining "your nation's interests" you are already defining and us v. them situation. And not in opposition to your own interests, like you have defined it, but in relation to the interests of other countries. That is the inherent problem, in my opinion.

I disagree. A man who overthrows a tyrant is a patriot, because he undertakes grave risk for the benefit of the nation at large. There doesn't have to be any other country in the world for that to be true. If there is no other nation in the world, it's nonsense to define a nation's interests agains those of another. QED.

Mighty Jalapeno wrote:I do not put Canada's interests above my own, but take them into consideration when I am doing things which may AFFECT Canada. I am not inherently proud to be Canadian.... my parents fucked here, I didn't have much say in it. However, I have learned to be proud of many aspects of what this country has done, in terms of policy and action, both domestic and abroad. I've acquired a sense of respect. I am not patriotic, or nationalistic, insofar as those words can be defined any way used here.

I'd submit that when you feel proud of things that Canada has accomplished, but that you weren't involved in (for instance, as an American, I say "we" beat the Nazis in WWII, even though I obviously had nothing to do with that), that's an instance of nationalism. Of course this doesn't make you a nationalist, any more than my being rude to a waitress that one time makes me an asshole.
Felstaff wrote:Serves you goddamned right. I hope you're happy, Cake Ruiner

User avatar
Mighty Jalapeno
Inne Juste 7 Dayes I Wille Make You A Hero!
Posts: 11265
Joined: Mon May 07, 2007 9:16 pm UTC
Location: Prince George In A Can
Contact:

Re: What is "patriotism"?

Postby Mighty Jalapeno » Wed Mar 12, 2008 9:23 pm UTC

I'm a nationalist for almost every nation, then... I'm proud of many other countries for things they've done, too.

Bluecold
Posts: 53
Joined: Sat Oct 20, 2007 1:13 pm UTC

Re: What is "patriotism"?

Postby Bluecold » Wed Mar 12, 2008 10:35 pm UTC

Name people who are patriots (not were, but are).
Maybe that will help defining.

User avatar
Ari
Posts: 725
Joined: Sun Oct 07, 2007 5:09 pm UTC
Location: Wellington, New Zealand

Re: What is "patriotism"?

Postby Ari » Thu Mar 13, 2008 5:07 am UTC

Silas wrote:I'm surprised by all the controversy here... oh, wait, it's just people who don't like the idea of nationalism hating on those that do. And a little bit of vice versa.

Patriotism is very simple: it's putting your nation's (patria, Latin) interests above your own. It's being a team player, when the 'team' is the nation, or being a family man (or company man, for that matter), but with the family (or company) replaced with the nation.

It's closely related to (but not the same as) nationalism: the belief that nations are a relevant frame of reference for evaluating us-or-them situations.

As for all the examples anyone can bring up for (usually right-wing) people using patriotism as a club to bludgeon their political adversaries, it's no more or less "true" than when (usually left-wing) people use callousness and 'being in the pocket of big Oil' as a club to bludgeon their own political adversaries. It's not that the concept has no merit, it's that it's being used disingenuously to make guilt-by-association pleas.


Part of what causes this disagreement about whether patriotism is good or not is that we all like different things about our countries and one person's patriotism is another one's heartlessness, and another's patriotism might seem to be cowardice to me- we have different value-judgements about what makes a good country and what advances a country's interest.

The other part is that some people seem to confuse legitimate problems that are brought up with immature complaints and slandering of your nation. (and I mean the confusion runs in both directions) "We're perceived as being in the pocket of oil companies" is intended as legitimate criticism and I don't think it deserves to be looked down on, just corrected if wrong. "Oh me yarm bush oil nom nom nom" is just transparently being a douche ;)

I think you're also defining patriotism in a rather weird way. Your definition is certainly necessary, but I'd question if it's sufficient. Some people would view a politician who built their career on exposing corruption as a patriot, even though their interests and their nation's interests were clearly aligned, and there was no sacrifice for the greater good.

Mighty Jalapeno wrote:I'm a nationalist for almost every nation, then... I'm proud of many other countries for things they've done, too.


That's actually far more likely to make you a globalist ;)
"Hey %*&^er, offensive communication works fine so long as you do it respectfully." :D
"I am so quoting that out of context at a later date."

User avatar
KevorkianKat
Posts: 192
Joined: Mon Jun 04, 2007 1:32 pm UTC

Re: What is "patriotism"?

Postby KevorkianKat » Thu Mar 13, 2008 5:29 pm UTC

Here's one for you:

I would define the people who voted against the Patriot Act patriots. I would define people who voted for it extremist nationalists.

User avatar
Sour Apple
Posts: 231
Joined: Tue Feb 26, 2008 12:17 am UTC
Location: USA
Contact:

Re: What is "patriotism"?

Postby Sour Apple » Fri Mar 14, 2008 4:44 am UTC

Why is it patriotic to vote against the Patriot Acts? Isn't it unpatriotic to not allow the government to invade every facet of your personal life in the name of fighting terrorism? [Note: In case anyone didn't pick up on this, I'm being completely facetious.]
Who I am. [Apparently this isn't obvious: I'm a chick, a bird, a female of your species.]

DougP
Posts: 42
Joined: Sun Feb 03, 2008 6:03 am UTC

Re: What is "patriotism"?

Postby DougP » Fri Mar 14, 2008 6:55 am UTC

Silas wrote:I disagree. A man who overthrows a tyrant is a patriot, because he undertakes grave risk for the benefit of the nation at large. There doesn't have to be any other country in the world for that to be true. If there is no other nation in the world, it's nonsense to define a nation's interests agains those of another. QED.



So Patriotism implies selflessness, while nationalism implies selfishness? Is that what you are getting at? If so, thats a very odd definition.

Silas
Posts: 1091
Joined: Sat Feb 02, 2008 9:08 pm UTC

Re: What is "patriotism"?

Postby Silas » Fri Mar 14, 2008 6:58 am UTC

In the first place, it's not the Patriot Act, its name is the USA PATRIOT act- don't ever forget about the uniting and strengthening of America.

But more importantly, how is it any more productive to accuse people of being unpatriotic for supporting a certain piece of legislation than for them to accuse their opponents of the same thing by coming up with a stupid name? Your name-calling isn't any better than theirs.

What really disturbs me about this whole patriotism thread is that it feels like the political Left has acquired a terrible habit. Accused of lacking some virtue (patriotism, sobriety, propriety and commitment to national service come to mind), we've taken to defending ourselves, not by pointing out that we possess that virtue, not by pointing out that our slanderers are ever more wanting than ourselves, but by insisting that that virtue wasn't valuable in the first place. God help us if somebody says leftists are all wifebeaters.


Edit:
DougP wrote:So Patriotism implies selflessness, while nationalism implies selfishness? Is that what you are getting at? If so, thats a very odd definition.

Well, yes, in the same way that a man who sacrifices everything for his family, but does so at the expense of other families is simultaneously selfish (with respect to the community at large) and selfless (with respect to his family).
Felstaff wrote:Serves you goddamned right. I hope you're happy, Cake Ruiner

DougP
Posts: 42
Joined: Sun Feb 03, 2008 6:03 am UTC

Re: What is "patriotism"?

Postby DougP » Fri Mar 14, 2008 7:06 am UTC

Silas wrote: Accused of lacking some virtue (patriotism, sobriety, propriety and commitment to national service come to mind), we've taken to defending ourselves, not by pointing out that we possess that virtue, not by pointing out that our slanderers are ever more wanting than ourselves, but by insisting that that virtue wasn't valuable in the first place.


I am not doing this in response to some attack, but simply that I came to the conclusion, on my own some years ago, that the concept of the nation state is entirely convoluted, and is likely going to end with most everyone blowing the crap out of each other. Included in patriotism is the tacit acceptance of nation-states as valuable or useful concept. So no, I would say patriotism ISN'T valuable in the first place, because it places the abstract concept of the nation above that of the actual people, which are the important things.

Silas
Posts: 1091
Joined: Sat Feb 02, 2008 9:08 pm UTC

Re: What is "patriotism"?

Postby Silas » Fri Mar 14, 2008 7:19 am UTC

I never said you were. It's just a vague feeling that the Left as an institution has this bad habit.

But you've hit on the key point. "Patriotism" is "the civic virtue of the nation-state," just as "incorruptibility" is "the civic virtue of the republic*." And if you disbelieve in the worth of the nation-state, you'll disbelieve in the worth of patriotism.

*where "republic" refers to that form of government that holds that its legitimacy is derived from its adherence to the Law.

We can debate the moral worth of the nation-state if you want, and this is as good a thread for it as any; I'd say more, but it's three fifteen in the morning.
Felstaff wrote:Serves you goddamned right. I hope you're happy, Cake Ruiner

User avatar
SlyReaper
inflatable
Posts: 8015
Joined: Mon Dec 31, 2007 11:09 pm UTC
Location: Bristol, Old Blighty

Re: What is "patriotism"?

Postby SlyReaper » Fri Mar 14, 2008 5:26 pm UTC

Patriotism is having pride in, or love for, ones own nation, perhaps due to past and present achievements, or simply the way of life there. Nationalism is the belief that ones own nation is superior to all other nations simply by virtue of having been born in it.

Alas, it's apparently quite easy to confuse the two.
Image
What would Baron Harkonnen do?

thicknavyrain
ThinkGravyTrain
Posts: 913
Joined: Sun Sep 30, 2007 12:41 pm UTC
Location: The Universe

Re: What is "patriotism"?

Postby thicknavyrain » Fri Mar 14, 2008 5:52 pm UTC

I agree with the previous post but fail to understand why people take pride in a nations past successes when perhaps the nation they live in today is a ghost of it's former self. What really gets to me though is how some people brag about their country's accomplishments when they have not done anything to help their country themselves. It's just unfortunate positioning these people are born in countries that achieved some small feat to be proud of and then go on to brag about it when there is every chance they may have been born somewhere else altogether. Then what?
RoadieRich wrote:Thicknavyrain is appointed Nex Artifex, Author of Death of the second FaiD Assassins' Guild.

zahlman
Posts: 638
Joined: Wed Jan 30, 2008 5:15 pm UTC

Re: What is "patriotism"?

Postby zahlman » Fri Mar 14, 2008 6:04 pm UTC

I'm not sure how I would define patriotism, but I sure don't think that "responding to a terrorist attack by allowing the government to immerse society in a culture of fear" is part of that definition.
Belial wrote:I once had a series of undocumented and nonstandardized subjective experiences that indicated that anecdotal data is biased and unreliable.

User avatar
SlyReaper
inflatable
Posts: 8015
Joined: Mon Dec 31, 2007 11:09 pm UTC
Location: Bristol, Old Blighty

Re: What is "patriotism"?

Postby SlyReaper » Fri Mar 14, 2008 6:16 pm UTC

thicknavyrain wrote:I agree with the previous post but fail to understand why people take pride in a nations past successes when perhaps the nation they live in today is a ghost of it's former self. What really gets to me though is how some people brag about their country's accomplishments when they have not done anything to help their country themselves. It's just unfortunate positioning these people are born in countries that achieved some small feat to be proud of and then go on to brag about it when there is every chance they may have been born somewhere else altogether. Then what?


If your country once achieved something great, there is always the hope it can achieve similar things in the future. A future that perhaps the bragger may be a part of. As an Englishman, I know people (including myself) who feel pride for things like the battle of Waterloo, having arguably the best navy in the world for hundreds of years, and the existence of an empire that the sun would never set on.

Spoiler:
Why would the sun never set on the British Empire? Because God wouldn't trust an Englishman in the dark. :P


But I'm quite aware that these are past glories and I claim no personal pride in them. Nor does anyone I know. However, it is something to aspire to.

And before you say it, yes I am also well aware of some of the less glorious parts of England's history. Funny how things like the Glorious Revolution of 1688 are less well documented in English history books than the battle of the Nile. :P
Image
What would Baron Harkonnen do?

thicknavyrain
ThinkGravyTrain
Posts: 913
Joined: Sun Sep 30, 2007 12:41 pm UTC
Location: The Universe

Re: What is "patriotism"?

Postby thicknavyrain » Fri Mar 14, 2008 7:04 pm UTC

It may interest you to know that I myself am in fact an Englishman, and still lives here. As a student in History I can understand your point. Learning about how Britain fought (for the most part) quite valiantly in WW2 did inspire me and I suppose a lot of it was to do with the fact that I felt a little proud of my nation. But today, I look around and although the country is run surprisingly well and remains intact despite the media's constant bombardment, I can't help but feel it could do better. I guess I would only make the choice to speak pridefully about the nation until I've done my fair share for it and know that my contributions helped make a difference. And I agree with your point about the future, I hope to help improve this country, if only on the scale one person can achieve, and it's not just because I grew up here. It's the fact that I want to make it, and other places, better for people like me to grow up in, in the future (Well, that and geographical convenience)
RoadieRich wrote:Thicknavyrain is appointed Nex Artifex, Author of Death of the second FaiD Assassins' Guild.

prysorra
Posts: 45
Joined: Mon Jun 18, 2007 4:37 am UTC

Re: What is "patriotism"?

Postby prysorra » Fri Mar 14, 2008 9:27 pm UTC

Patriotism and nationalism are orthogonal properties. They are related, but only thus.

Proposition 1:
A Patriotism in its purest form can be reduced to "societal heroism".
B Nationalism in its purest form can be reduced to "societal chauvinism".
C Heroism is the Y axis, chauvinism is the X axis.

Proposition 2:
A Patriotism in its purest form can be reduced to "sacrifice of self for the common good"
B Nationalism in its purest form can be reduced to "sacrifice of others for the common good"

Proposition 3:
A Patriotism is behavior that models an idealized member of the given society
B Nationalism is behavior that advances the interests of the given society

User avatar
SlyReaper
inflatable
Posts: 8015
Joined: Mon Dec 31, 2007 11:09 pm UTC
Location: Bristol, Old Blighty

Re: What is "patriotism"?

Postby SlyReaper » Fri Mar 14, 2008 9:42 pm UTC

prysorra wrote:Patriotism and nationalism are orthogonal properties. They are related, but only thus.

Proposition 1:
A Patriotism in its purest form can be reduced to "societal heroism".
B Nationalism in its purest form can be reduced to "societal chauvinism".
C Heroism is the Y axis, chauvinism is the X axis.

Proposition 2:
A Patriotism in its purest form can be reduced to "sacrifice of self for the common good"
B Nationalism in its purest form can be reduced to "sacrifice of others for the common good"

Proposition 3:
A Patriotism is behavior that models an idealized member of the given society
B Nationalism is behavior that advances the interests of the given society


The problem with couching such things in mathematical terms is that an actual mathematician (there are a fair few of them lurking in these forums) is going to come along and tell you you're talking a load of bullshit. Why do we need an X and Y axis? Two properties that are orthogonal to each other? In what space? Is there some kind of vector space we're working with here? Not to mention you have three propositions and zero proofs. Define "common good" - is that what's good for the nation or good for the world?
Image
What would Baron Harkonnen do?

prysorra
Posts: 45
Joined: Mon Jun 18, 2007 4:37 am UTC

Re: What is "patriotism"?

Postby prysorra » Sat Mar 15, 2008 9:12 am UTC

SlyReaper wrote:Define "common good" - is that what's good for the nation or good for the world?


Such would be a matter of opinion anyway. The point was that the "common good" needs have the same meaning in both instances.

SlyReaper wrote:Not to mention you have three propositions and zero proofs

http://en.wikipedia.org/wiki/Axiom. I have chosen my terminology poorly.

Patriotism is by societal definition a universally positive attribute. It's like a weeble-wobble toy. The society in question will resettle itself upon a definition is agrees upon. Nothing more, nothing less. I was purposely vague on what these desired "patriotic" characteristics are, as societal ideals are transient, and subject to the mercurial winds of social change.

SlyReaper wrote:Is there some kind of vector space we're working with here?


Yes. All human opinion. I am merely defining a subspace of ℝ2 in which they exist as independently distillable attributes.

Or, I can get some sleep. The mathematics of abstract human characteristics and their organization makes me sleepy.

I want candy!


...........

OOOOO

It took me a minute, but remembered AFTER I went to get some candy. Yummy candy.

Those propositions don't overlap. It's not like I'm assuming all three propositions exist in the same euclidean space. o_o.

That way madness lies. As do math-nazi trolls.


Return to “Serious Business”

Who is online

Users browsing this forum: No registered users and 13 guests