Oprah pwned by /b/

Seen something interesting in the news or on the intertubes? Discuss it here.

Moderators: Zamfir, Hawknc, Moderators General, Prelates

User avatar
DarkKnightJared
Posts: 268
Joined: Fri Apr 11, 2008 8:10 am UTC
Location: Arizona
Contact:

Re: Oprah pwned by /b/

Postby DarkKnightJared » Thu Sep 25, 2008 3:49 pm UTC

GreaterSteven wrote:Oh God...you almost have to pity her, for what is going to happen.


I won't. At all. :twisted:

User avatar
iamfree
Posts: 121
Joined: Fri Feb 29, 2008 5:11 pm UTC
Location: Virginia

Re: Oprah pwned by /b/

Postby iamfree » Thu Sep 25, 2008 4:38 pm UTC

Cheese wrote:Papers don't sell news; they sell papers.


Papers don't sell paps, newsies sell paps.

Oprah is a tool and I've been trying to convince people that for years. Now she has done the convincing for me.
GACAACGCACGCAACGCGCCCCGGACCACCUAA

just let It happen

User avatar
22/7
I'm pretty sure I have "The Slavery In My Asshole" on DVD.
Posts: 6475
Joined: Fri Jul 06, 2007 3:30 pm UTC
Location: 127.0.0.1

Re: Oprah pwned by /b/

Postby 22/7 » Thu Sep 25, 2008 5:05 pm UTC

iamfree wrote:
Cheese wrote:Papers don't sell news; they sell papers.


Papers don't sell paps, newsies sell paps.
I wondered if anyone was going to make a Newsies reference.

iamfree wrote:Oprah is a tool and I've been trying to convince people that for years. Now she has done the convincing for me.

Well of course she is. She's been giving parenting and marriage advice for years without one of the key qualifications for either.
Totally not a hypothetical...

Steroid wrote:
bigglesworth wrote:If your economic reality is a choice, then why are you not as rich as Bill Gates?
Don't want to be.
I want to be!

Abstruse
Posts: 129
Joined: Tue Sep 02, 2008 10:17 am UTC

Re: Oprah pwned by /b/

Postby Abstruse » Thu Sep 25, 2008 5:30 pm UTC

22/7 wrote:
iamfree wrote:
Cheese wrote:Papers don't sell news; they sell papers.


Papers don't sell paps, newsies sell paps.
I wondered if anyone was going to make a Newsies reference.


Crips, Bloods, Latin Kings, Warriors. . . Newsies.

ParanoidDrone
Posts: 514
Joined: Sun Jan 06, 2008 6:38 am UTC
Location: idk ask my bff jill

Re: Oprah pwned by /b/

Postby ParanoidDrone » Fri Sep 26, 2008 3:04 am UTC

Damn, Oprah got owned and she didn't even realize it. Hell, even my mom thought it was funny.
Insert witty phrase here.

Joeldi
Posts: 1055
Joined: Sat Feb 17, 2007 1:49 am UTC
Location: Central Queensland, Australia
Contact:

Re: Oprah pwned by /b/

Postby Joeldi » Fri Sep 26, 2008 9:03 am UTC

ConMan wrote:Don't be silly, she looks nothing like Karl Stephanovic.
*will be surprised if anyone gets this reference*


I get it. I remember when the chaser was all up in this shit
I already have a hate thread. Necromancy > redundancy here, so post there.

roc314 wrote:America is a police state that communicates in txt speak...

"i hav teh dissentors brb""¡This cheese is burning me! u pwnd them bff""thx ur cool 2"

User avatar
ConMan
Shepherd's Pie?
Posts: 1691
Joined: Tue Jan 01, 2008 11:56 am UTC
Location: Beacon Alpha

Re: Oprah pwned by /b/

Postby ConMan » Mon Sep 29, 2008 6:28 am UTC

Joeldi wrote:
ConMan wrote:Don't be silly, she looks nothing like Karl Stephanovic.
*will be surprised if anyone gets this reference*


I get it. I remember when the chaser was all up in this shit


Chaser? No, different mob.
pollywog wrote:
Wikihow wrote:* Smile a lot! Give a gay girl a knowing "Hey, I'm a lesbian too!" smile.
I want to learn this smile, perfect it, and then go around smiling at lesbians and freaking them out.

User avatar
Jasiel
Posts: 9
Joined: Fri Oct 03, 2008 2:31 am UTC

Re: Oprah pwned by /b/

Postby Jasiel » Fri Oct 03, 2008 2:57 am UTC

Well played, Anon.
Well played.
SCIENCE.
"It works, bitches."

User avatar
Jebobek
Posts: 2219
Joined: Tue Jun 17, 2008 7:19 pm UTC
Location: Harrisburg, Pennsylvania Geohash graticule

Re: Oprah pwned by /b/

Postby Jebobek » Fri Oct 03, 2008 5:12 pm UTC

The videos are hilarious on youtube. I cant spell his name but the origional maker of "OVER 9000!!!" should be flipping out from irony hilarity.

I know pedobear is an often-used image from /b/ but could anyone explain the origin?
Image

User avatar
Darkscull
Posts: 798
Joined: Wed Jan 23, 2008 10:46 am UTC
Location: Now where I want to be

Re: Oprah pwned by /b/

Postby Darkscull » Fri Oct 03, 2008 5:14 pm UTC

not gonna link it, but encyclopedia dramatica is (sometimes) a good source of info on memes. You have to be able to tell what's not serious though (not that any of it's serious, but you get what I mean, I hope)
Physicists do it in an excited state.
m/bi/UK/Ⓐ/chaotic good
b. 1988 d. 20xx

User avatar
Babam
the Nearly Deleted
Posts: 1170
Joined: Tue Apr 01, 2008 2:05 am UTC
Location: A multiverse, wandering the couch
Contact:

Re: Oprah pwned by /b/

Postby Babam » Sat Oct 04, 2008 2:00 am UTC

The only reason the person said OVER 9000 is because the word two or most any other number is wordfilterd to OVER 9000 on /b/
Over 9000 is old and really really boring.
You can find the origin of Pedobear on ED.
I the xkcdian/b/tard have spoken!
*flys into the shadows with a /b/atling gun
Spoiler:
crucialityfactor wrote:I KNEW he could club bitches!

SecondTalon wrote:Reality - More fucked up than Photoshop.

s/notwittysig/wittysig

Green9090
Posts: 516
Joined: Mon Jun 18, 2007 8:40 pm UTC
Location: California

Re: Oprah pwned by /b/

Postby Green9090 » Sat Oct 04, 2008 2:48 am UTC

Babamthegrunt wrote:The only reason the person said OVER 9000 is because the word two or most any other number is wordfilterd to OVER 9000 on /b/
Over 9000 is old and really really boring.
You can find the origin of Pedobear on ED.
I the xkcdian/b/tard have spoken!
*flys into the shadows with a /b/atling gun

If you are a /b/tard, it's only barely. 2 and 7 are wordfiltered to over 9000, but only since VERY, VERY recently. The reason they said over 9000 is because it's a meme, and had nothing to do with the wordfilters.

I believe "toddler" is the technical term.
Belial wrote:A man with more arms than the entire hindu pantheon and thirty goddamn dicks has no time for logic! He must consume ever more bacon to fuel his incalculable manhood!

User avatar
Jesse
Vocal Terrorist
Posts: 8635
Joined: Mon Jul 03, 2006 6:33 pm UTC
Location: Basingstoke, England.
Contact:

Re: Oprah pwned by /b/

Postby Jesse » Sat Oct 04, 2008 8:31 am UTC

Everyone knows LE4d s xkcd's true /b/tard.

Joeldi
Posts: 1055
Joined: Sat Feb 17, 2007 1:49 am UTC
Location: Central Queensland, Australia
Contact:

Re: Oprah pwned by /b/

Postby Joeldi » Sat Oct 04, 2008 9:03 am UTC

>>Green9090

Troll'd

...Anyway, at the time of writing, only 7 wordfilters, and it's been like that for at least a week. Prior to that it was 2. I dunno if they both filtered to over 9000 at some time.

On topic, I always find this sort of thing hilarious, because I just like being "in on the joke" y'know. It feels good to know what's going on.
I already have a hate thread. Necromancy > redundancy here, so post there.

roc314 wrote:America is a police state that communicates in txt speak...

"i hav teh dissentors brb""¡This cheese is burning me! u pwnd them bff""thx ur cool 2"

User avatar
Maseiken
The Candylawyer
Posts: 2827
Joined: Sat May 19, 2007 11:13 am UTC

Re: Oprah pwned by /b/

Postby Maseiken » Sat Oct 04, 2008 11:27 am UTC

Looks like Babam needs to Lurk Moar.
"GRRRRRRRRRROOOOOOOOWR!!!!"
(Translation: "Objection!")

Maseiken had the ball at the top of the key...

User avatar
Cheese
and spam. (Euggh)
Posts: 3909
Joined: Mon Jul 02, 2007 2:04 pm UTC
Location: ¿burning you?

Re: Oprah pwned by /b/

Postby Cheese » Sat Oct 04, 2008 1:09 pm UTC

Jesse wrote:Everyone knows LE4d s xkcd's true /b/tard.
...so wing is LE4d's true arch-nemisis?
hermaj wrote:No-one. Will. Be. Taking. Cheese's. Spot.
Spoiler:
LE4dGOLEM wrote:Cheese is utterly correct on all fronts.
SecondTalon wrote:That thing that Cheese just said. Do that.
Meaux_Pas wrote:I hereby disagree and declare Cheese to be brilliant.
Image

Green9090
Posts: 516
Joined: Mon Jun 18, 2007 8:40 pm UTC
Location: California

Re: Oprah pwned by /b/

Postby Green9090 » Sat Oct 04, 2008 7:25 pm UTC

Green9090 wrote:I believe "toddler" is the technical term.

Lol, I try to remain civil by avoiding calling anyone anything ending in fag, and a mod corrects me.
Belial wrote:A man with more arms than the entire hindu pantheon and thirty goddamn dicks has no time for logic! He must consume ever more bacon to fuel his incalculable manhood!

User avatar
yukari koizumi
Posts: 36
Joined: Wed Feb 13, 2008 11:58 pm UTC
Contact:

Re: Oprah pwned by /b/

Postby yukari koizumi » Sun Oct 05, 2008 7:42 am UTC

Exotria wrote:/b/ will grab onto this and never leave her show alone again. She's going to have to hire someone just to deal with them and make sure she doesn't give them any broadcast attention. Which means someone who regularly visits 4chan is going to be employed there. Which... could backfire with hilarious results, assuming she actually does hire someone to deal with them.

Also, wtf at using sources from message boards. Not very good journalism.

Oprah is rich enough I bet she could afford to hunt them down and kill them if she wanted to.....

User avatar
Babam
the Nearly Deleted
Posts: 1170
Joined: Tue Apr 01, 2008 2:05 am UTC
Location: A multiverse, wandering the couch
Contact:

Re: Oprah pwned by /b/

Postby Babam » Mon Oct 06, 2008 12:39 am UTC

Green9090 wrote:
Green9090 wrote:I believe "toddler" is the technical term.

Lol, I try to remain civil by avoiding calling anyone anything ending in fag, and a mod corrects me.

Meh, I'm a geezer I gurantee it.
I know most people do it out of wordfilter habit or meme.
besides over 9000 is boring...
Spoiler:
crucialityfactor wrote:I KNEW he could club bitches!

SecondTalon wrote:Reality - More fucked up than Photoshop.

s/notwittysig/wittysig

User avatar
clintonius
Posts: 2755
Joined: Wed May 07, 2008 9:13 pm UTC
Location: Brooklyn

Re: Oprah pwned by /b/

Postby clintonius » Mon Oct 06, 2008 12:42 am UTC

Is anybody else confused as all fuck?

. . . or at least bothered by the cacaphony of "a geezer?"
kira wrote:*piles up some limbs and blood and a couple hearts for good measure*
GUYS. I MADE A HUMAN.
*...pokes at it with a stick*

Green9090
Posts: 516
Joined: Mon Jun 18, 2007 8:40 pm UTC
Location: California

Re: Oprah pwned by /b/

Postby Green9090 » Mon Oct 06, 2008 1:22 am UTC

clintonius wrote:. . . or at least bothered by the cacaphony of "a geezer?"

I gurantee it :lol:
Belial wrote:A man with more arms than the entire hindu pantheon and thirty goddamn dicks has no time for logic! He must consume ever more bacon to fuel his incalculable manhood!

User avatar
clintonius
Posts: 2755
Joined: Wed May 07, 2008 9:13 pm UTC
Location: Brooklyn

Re: Oprah pwned by /b/

Postby clintonius » Mon Oct 06, 2008 1:49 am UTC

You, sir, win a pedantic internet. <3
kira wrote:*piles up some limbs and blood and a couple hearts for good measure*
GUYS. I MADE A HUMAN.
*...pokes at it with a stick*

User avatar
Maseiken
The Candylawyer
Posts: 2827
Joined: Sat May 19, 2007 11:13 am UTC

Re: Oprah pwned by /b/

Postby Maseiken » Mon Oct 06, 2008 6:53 am UTC

clintonius wrote:You, sir, win a pedantic internet. <3

Just make sure you don't accidentally the whole thing.
"GRRRRRRRRRROOOOOOOOWR!!!!"
(Translation: "Objection!")

Maseiken had the ball at the top of the key...

Green9090
Posts: 516
Joined: Mon Jun 18, 2007 8:40 pm UTC
Location: California

Re: Oprah pwned by /b/

Postby Green9090 » Mon Oct 06, 2008 7:21 am UTC

Maseiken wrote:
clintonius wrote:You, sir, win a pedantic internet. <3

Just make sure you don't accidentally the whole thing.

Is that bad? I mean, not that I did that or anything...
Belial wrote:A man with more arms than the entire hindu pantheon and thirty goddamn dicks has no time for logic! He must consume ever more bacon to fuel his incalculable manhood!

User avatar
Babam
the Nearly Deleted
Posts: 1170
Joined: Tue Apr 01, 2008 2:05 am UTC
Location: A multiverse, wandering the couch
Contact:

Re: Oprah pwned by /b/

Postby Babam » Mon Oct 06, 2008 11:18 pm UTC

Green9090 wrote:
Maseiken wrote:
clintonius wrote:You, sir, win a pedantic internet. <3

Just make sure you don't accidentally the whole thing.

Is that bad? I mean, not that I did that or anything...

Are you sure, I mean if you did accidentally the whole fleshlight you should talk to Ryan.
Spoiler:
crucialityfactor wrote:I KNEW he could club bitches!

SecondTalon wrote:Reality - More fucked up than Photoshop.

s/notwittysig/wittysig

zahlman
Posts: 638
Joined: Wed Jan 30, 2008 5:15 pm UTC

Re: Oprah pwned by /b/

Postby zahlman » Tue Oct 07, 2008 11:15 pm UTC

Babamthegrunt wrote:Meh, I'm a geezer I gurantee it.


Needs moar Zimmer! Also, all your base are belong to us!
Belial wrote:I once had a series of undocumented and nonstandardized subjective experiences that indicated that anecdotal data is biased and unreliable.

User avatar
PhantomReality
Posts: 329
Joined: Wed May 16, 2007 1:16 pm UTC
Location: The Chapel Thrill, NC
Contact:

Re: Oprah pwned by /b/

Postby PhantomReality » Wed Oct 08, 2008 6:19 pm UTC

Eventually we will all be bowing down to 4chan. Srsly it'll take over the world eventually if people continue to be completely and utterly retarded. Oh me yarm 4CHAN ATE MY BABIES!!!!!!!!!!!!
DROP ACID NOT BOMBS.

User avatar
william
Not a Raptor. Honest.
Posts: 2418
Joined: Sat Oct 14, 2006 5:02 pm UTC
Location: Chapel Hill, NC
Contact:

Re: Oprah pwned by /b/

Postby william » Wed Oct 08, 2008 11:11 pm UTC

PhantomReality wrote:Eventually we will all be bowing down to 4chan. Srsly it'll take over the world eventually if people continue to be completely and utterly retarded. Oh me yarm 4CHAN ATE MY BABIES!!!!!!!!!!!!

Well, yes, "completely and utterly retarded" is an apt description of 4chan.
SecondTalon wrote:A pile of shit can call itself a delicious pie, but that doesn't make it true.

User avatar
Blubb3r3ng3l
Posts: 352
Joined: Mon Mar 10, 2008 3:41 am UTC

Re: Oprah pwned by /b/

Postby Blubb3r3ng3l » Wed Oct 08, 2008 11:20 pm UTC

I think Oprah is a pretty cool guy. eh doesn't get jokes that have circulated the interbuttz for years and doesn't afraid of anything.

PS, LE4D is far from the only /b/tard. I've been on a hiatus for quite some time simply due to the lack of, well, original content recently, but I'm veeeeeeeery familiar with, well, everything from the last 3 years.

And I hate to say, in the context of 4chan, the suffix 'fag' is quite literally a term of endearment. Like, seriously. I hate the word everywhere else, but geezer, toddler, Macfag, etc really, REALLY doesn't bother me much.

Then again... I'm a guy who is able to watch another man's penis get cut off... so...


/cry

It's horrifying to see how desensitized /b/ has made me
Let us a little permit Nature to take her own way; she understands Her own affairs better than we ~ Montaigne
embarrass the hell out of me
The only emotion ducks can feel is hate. -__Kit

User avatar
Azrael
CATS. CATS ARE NICE.
Posts: 6491
Joined: Thu Apr 26, 2007 1:16 am UTC
Location: Boston

Re: Oprah pwned by /b/

Postby Azrael » Thu Oct 09, 2008 12:54 pm UTC

Blubb3r3ng3l wrote:PS, LE4D is far from the only /b/tard.

But he's the *official* one. Mostly because Jesse has deemed it to be so. Plus, LE4d is probably the least gorram annoying about it, too... :D

User avatar
Hawknc
Oompa Loompa of SCIENCE!
Posts: 6986
Joined: Mon Oct 02, 2006 5:14 am UTC
Location: Melbourne, Australia
Contact:

Re: Oprah pwned by /b/

Postby Hawknc » Thu Oct 09, 2008 1:29 pm UTC

He's also the only person who doesn't automatically go on my shitlist because they use *fag. Mostly because he doesn't use it all that often.

User avatar
Bakemaster
pretty nice future dick
Posts: 8933
Joined: Fri Jul 06, 2007 2:33 pm UTC
Location: One of those hot places

Re: Oprah pwned by /b/

Postby Bakemaster » Thu Oct 09, 2008 7:36 pm UTC

When did it become cool to brag about your knowledge of 4chan here?

Follow-up: How do we reverse this?

I blame Sarah Palin.
Image
c0 = 2.13085531 × 1014 smoots per fortnight
"Apparently you can't summon an alternate timeline clone of your inner demon, guys! Remember that." —Noc

User avatar
Cheese
and spam. (Euggh)
Posts: 3909
Joined: Mon Jul 02, 2007 2:04 pm UTC
Location: ¿burning you?

Re: Oprah pwned by /b/

Postby Cheese » Thu Oct 09, 2008 7:48 pm UTC

Because /b/ is forbidden territory, and those people who break the rules and go into the scary and dangerous places are automatically awarded high status in the social group. Well, when you're ten and there's that spooky boarded-up house across the road, in any case.
hermaj wrote:No-one. Will. Be. Taking. Cheese's. Spot.
Spoiler:
LE4dGOLEM wrote:Cheese is utterly correct on all fronts.
SecondTalon wrote:That thing that Cheese just said. Do that.
Meaux_Pas wrote:I hereby disagree and declare Cheese to be brilliant.
Image

Jack Saladin
X is kiss
Posts: 4445
Joined: Thu Jun 15, 2006 8:22 am UTC
Location: Aotearoa

Re: Oprah pwned by /b/

Postby Jack Saladin » Thu Oct 09, 2008 10:51 pm UTC

That might make sense if /b/ was actually scary and dangerous instead of a bunch of 14 year olds drawing pictures of dicks.

There are actually are dark, frightening places in the underbelly of the internet, but /b/ is not one of them. /b/ is Myspace for social rejects*.

*I mean that in regards to its status on the internet, not its functionality.

User avatar
Blubb3r3ng3l
Posts: 352
Joined: Mon Mar 10, 2008 3:41 am UTC

Re: Oprah pwned by /b/

Postby Blubb3r3ng3l » Fri Oct 10, 2008 3:34 am UTC

Ah yes. Lets pick on the /b/tards.

I don't act any different from anybody else in any place besides where /b/ is mentioned in the title. It's simply fun for me to roleplay being a heinous person once or twice a week.

Blah. I'm done.
Let us a little permit Nature to take her own way; she understands Her own affairs better than we ~ Montaigne
embarrass the hell out of me
The only emotion ducks can feel is hate. -__Kit

User avatar
22/7
I'm pretty sure I have "The Slavery In My Asshole" on DVD.
Posts: 6475
Joined: Fri Jul 06, 2007 3:30 pm UTC
Location: 127.0.0.1

Re: Oprah pwned by /b/

Postby 22/7 » Fri Oct 10, 2008 1:30 pm UTC

Blubb3r3ng3l wrote:Ah yes. Lets pick on the /b/tards.

I don't act any different from anybody else in any place besides where /b/ is mentioned in the title. It's simply fun for me to roleplay being a heinous person once or twice a week.

Blah. I'm done.
Saladin actually just backed you up (well, some). That might be your only one. Ever. Just sayin'.
Totally not a hypothetical...

Steroid wrote:
bigglesworth wrote:If your economic reality is a choice, then why are you not as rich as Bill Gates?
Don't want to be.
I want to be!

Green9090
Posts: 516
Joined: Mon Jun 18, 2007 8:40 pm UTC
Location: California

Re: Oprah pwned by /b/

Postby Green9090 » Fri Oct 10, 2008 4:46 pm UTC

Bakemaster wrote:When did it become cool to brag about your knowledge of 4chan here?

Follow-up: How do we reverse this?

I blame Sarah Palin.

Maybe it's not so much that it's cool as that the thread is about /b/.
Belial wrote:A man with more arms than the entire hindu pantheon and thirty goddamn dicks has no time for logic! He must consume ever more bacon to fuel his incalculable manhood!

The Reaper
Posts: 4008
Joined: Fri Oct 12, 2007 5:37 am UTC
Location: San Antonio, Tx
Contact:

Re: Oprah pwned by /b/

Postby The Reaper » Sun Oct 12, 2008 4:52 pm UTC

inafteraids.

Iv
Posts: 1207
Joined: Thu Sep 13, 2007 1:08 pm UTC
Location: Lyon, France

Re: Oprah pwned by /b/

Postby Iv » Mon Oct 13, 2008 9:34 am UTC

4chan is the "Internet hate machine". It has been dubbed as this on CNN and it is now in their title. I love it for that! /b/ is some sort of primeval Internet chaos. The place where signal/noise ratio approaches zero. It is good to see what is the limit state of a forum without moderation.

Actually, the first time I got there (1 or 2 years maybe, it is the scientology thing that brought me there) I was surprised that it was actually more elaborated than your usual Youtube commenting crowd : it is downright trash, but there is irony, some culture and a lot of dark humor. I suspect that more people are roleplaying "internet hate machines" there than genuinely heinous people.

User avatar
Azrael
CATS. CATS ARE NICE.
Posts: 6491
Joined: Thu Apr 26, 2007 1:16 am UTC
Location: Boston

Re: Oprah pwned by /b/

Postby Azrael » Mon Oct 13, 2008 3:44 pm UTC

This thread, nor the people in it, need neither a primer nor your personal reminiscences on 4chan. Really.


Return to “News & Articles”

Who is online

Users browsing this forum: No registered users and 21 guests